HUGE |
Gene/Protein Characteristic Table for KIAA1771 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB051558 |
Description : | Dedicator of cytokinesis protein 7. |
HUGO Gene Name : | dedicator of cytokinesis 7 (DOCK7) |
Clone Name : | pj02581 [Vector Info] |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4420 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: NO | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 401 bp Genome contig ID gi89161185r_62593272 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
TTAAAGGTACTATTAAATATGTGAATGTTTACACTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATTTTACCGAGTGGGACTTCAAAATTTTTATTATTGACAATGGCAGAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 62693272 62794193 29 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1302 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AAATGCTTCAGATGGTACTCC | |
: TGATCCGGCCCAATTAAGCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |