HUGE

Gene/Protein Characteristic Table for KIAA1058

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00726
Accession No. :	AB028981
Description :	Dedicator of cytokinesis protein 9.
HUGO Gene Name :	dedicator of cytokinesis 9 (DOCK9)
Clone Name :	hh12146s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1058
Source :	Human adult brain
Note :	We replaced hh12146, former representative clones for KIAA1058 with hh12146s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7545 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1257 bp

Genome contig ID gi51511729r_98143745
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TGTACCACATCTGTATTAAAAAGACATTGCTGACC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTGGGGTGGCTGCTGGGTGTTTATTGTTCAGCAGTCCTAAGGGAACAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 98243745 98428245 55 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 2095 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001090732	99.7	dedicator of cy...	Macaca mulatta
CAI13370	100.0	novel protein [...	Homo sapiens
Q9BZ29	100.0	Dedicator of cy...	Homo sapiens
XP_001145143	99.9	dedicator of cy...	Pan troglodytes
XP_509710	99.8	dedicator of cy...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037816	1.5e-35	30.7	KIAA1395
AB051558	5.3e-35	31.7	KIAA1771
AB014594	2.8e-25	47.2	KIAA0694

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 201 307 PF00169 Pleckstrin-like

IPR010703 1911 2090 PF06920 Dedicator of cytokinesis

HMMSmart IPR001849 201 309 SM00233 Pleckstrin-like

ProfileScan IPR001849 200 307 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	201	307	PF00169	Pleckstrin-like
IPR010703	1911	2090	PF06920	Dedicator of cytokinesis
HMMSmart	IPR001849	201	309	SM00233	Pleckstrin-like
ProfileScan	IPR001849	200	307	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGCGCGAGCTTTCTTAGATG

Primer_r
: TTCTTCCTGATACTCGAGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1257 bp
Genome contig ID	gi51511729r_98143745
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TGTACCACATCTGTATTAAAAAGACATTGCTGACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGGGGTGGCTGCTGGGTGTTTATTGTTCAGCAGTCCTAAGGGAACAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	98243745	98428245	55	99.6	Perfect prediction

Primer_f	: ATGCGCGAGCTTTCTTAGATG
Primer_r	: TTCTTCCTGATACTCGAGCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1058

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information