HUGE

Gene/Protein Characteristic Table for KIAA0694

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00608
Accession No. :	AB014594
Description :	Dedicator of cytokinesis protein 10.
HUGO Gene Name :	dedicator of cytokinesis 10 (DOCK10)
Clone Name :	hk03987s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0694
Source :	Human adult brain
Note :	We replaced hk03987, former representative clones for KIAA0694 with hk03987s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4008 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1987 bp

Genome contig ID gi89161199r_225333842
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCAGCCTGGGCAACAGAGTGAGACCCTGTCTCT
Flanking genome sequence
(99699 - 99650)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAGAAAAAAAAAACGCTCTATCCTTTATTAGCCAAGTGAGCTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 225433541 225615574 14 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 595 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW70832	100.0	dedicator of cy...	Homo sapiens
Q96BY6	100.0	Dedicator of cy...	Homo sapiens
EAW70834	99.8	dedicator of cy...	Homo sapiens
EAW70835	99.8	dedicator of cy...	Homo sapiens
NP_055504	99.8	dedicator of cy...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028981	1.6e-25	47.2	KIAA1058

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 184 292 PF00169 Pleckstrin-like

HMMSmart IPR001849 184 294 SM00233 Pleckstrin-like

ProfileScan IPR001849 183 292 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	184	292	PF00169	Pleckstrin-like
HMMSmart	IPR001849	184	294	SM00233	Pleckstrin-like
ProfileScan	IPR001849	183	292	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AGGAACAACTAATGCCAGGAC

Primer_r
: AGGGAACTGAGAATGCTTAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGAACAACTAATGCCAGGAC
Primer_r	: AGGGAACTGAGAATGCTTAAC
PCR product length	: 168 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1987 bp
Genome contig ID	gi89161199r_225333842
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAGAGTGAGACCCTGTCTCT
Flanking genome sequence (99699 - 99650)	----+--------+--------+--------+--------+----* AAAAAAAAGAAAAAAAAAACGCTCTATCCTTTATTAGCCAAGTGAGCTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	225433541	225615574	14	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0694

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information