HUGE

Gene/Protein Characteristic Table for KIAA0299

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04820
Accession No. :	AB002297
Description :	Dedicator of cytokinesis protein 3.
HUGO Gene Name :	dedicator of cytokinesis 3 (DOCK3)
Clone Name :	hf00368 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 8063 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1907 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IZD9	100.0	Dedicator of cy...	Homo sapiens
XP_516488	99.9	dedicator of cy...	Pan troglodytes
XP_533813	98.8	similar to dedi...	Canis lupus fam...
XP_001493405	98.4	dedicator of cy...	Equus caballus
AAI67231	98.1	Dedicator of cy...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018259	6.4e-156	56.6	KIAA0716
D86964	3.9e-62	38.6	KIAA0209
AB051558	6.3e-05	23.9	KIAA1771

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010703 1320 1507 PF06920 Dedicator of cytokinesis

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010703	1320	1507	PF06920	Dedicator of cytokinesis

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGTTCTTATGTGATGACTGCC

Primer_r
: CTTCAATCTCTGGACCATCTG

PCR conditions
: 95 °C15 sec62 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGTTCTTATGTGATGACTGCC
Primer_r	: CTTCAATCTCTGGACCATCTG
PCR product length	: 150 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0299

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information