| HUGE |
Gene/Protein Characteristic Table for KIAA0211 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00460 |
|---|---|
| Accession No. : | D86966 |
| Description : | Zinc finger protein 592. |
| HUGO Gene Name : | zinc finger protein 592 (ZNF592) |
| Clone Name : | ha02768 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0211
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5086 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 712 bp Genome contig ID gi51511731f_82992584 PolyA signal sequence
(AATAAA,-19)
CTCAGACTATATTTCAAATAAAAAATCTTCTCACCFlanking genome sequence
(154948 - 154997)
ATGCAGGTAGGCTCTTGTATTCCTCTCCAAGTGAGCCTGGCCCCACCCTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 83092584 83147530 12 99.6 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1317 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 18 |
| : Genebridge 4 | |
| : AGCTCTGCCTAGTCTGGTTTG | |
| : CAAATGGCACGAGAGCAGTAC | |
| : 142 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
