HUGE

Gene/Protein Characteristic Table for KIAA1629

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07492
Accession No. :	AB046849
Description :	zinc finger protein 532.
HUGO Gene Name :
Clone Name :	fh20517 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh14869, former representative clones for KIAA1629 with fh20517. (2001/2/22)

Features of the cloned DNA sequence	Description

Length: 5595 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1477 bp

Genome contig ID gi51511735f_54583680
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ACACATTTCATATGTAAATAAACGTGGGACATTTG
Flanking genome sequence
(220478 - 220527)
----+----*----+----*----+----*----+----*----+----*
GCCCTTGTGCTTCTGTGAGAGAATTATTGATGGTGGGTCTCTGACATCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 54681688 54804156 11 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1329 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001089453	98.9	similar to zinc...	Macaca mulatta
Q9HCE3	100.0	Zinc finger pro...	Homo sapiens
BAG54624	99.9	unnamed protein...	Homo sapiens
EDM14687	91.8	zinc finger pro...	Rattus norvegicus
EDL09689	90.3	zinc finger pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037862	7.5e-44	36.4	KIAA1441
D86966	7.2e-40	40.2	KIAA0211
AB058730	0.00017	24.9	KIAA1827
AB075862	0.00019	23.7	KIAA1982
AB002324	0.00019	22.9	KIAA0326

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 870 893 PF00096 Zinc finger

IPR007087 898 921 PF00096 Zinc finger

IPR007087 933 955 PF00096 Zinc finger

IPR007087 964 987 PF00096 Zinc finger

IPR007087 1083 1106 PF00096 Zinc finger

IPR007087 1231 1254 PF00096 Zinc finger

IPR007087 1292 1314 PF00096 Zinc finger

HMMSmart IPR015880 644 664 SM00355 Zinc finger

IPR015880 672 696 SM00355 Zinc finger

IPR015880 782 802 SM00355 Zinc finger

IPR015880 811 833 SM00355 Zinc finger

IPR015880 839 863 SM00355 Zinc finger

IPR015880 870 893 SM00355 Zinc finger

IPR015880 898 921 SM00355 Zinc finger

IPR015880 933 955 SM00355 Zinc finger

IPR015880 964 987 SM00355 Zinc finger

IPR015880 1053 1076 SM00355 Zinc finger

IPR015880 1083 1106 SM00355 Zinc finger

IPR015880 1113 1139 SM00355 Zinc finger

IPR015880 1202 1224 SM00355 Zinc finger

IPR015880 1231 1254 SM00355 Zinc finger

IPR015880 1292 1314 SM00355 Zinc finger

ProfileScan IPR007087 644 662 PS50157 Zinc finger

IPR007087 782 812 PS50157 Zinc finger

IPR007087 898 926 PS50157 Zinc finger

IPR007087 933 960 PS50157 Zinc finger

IPR007087 964 992 PS50157 Zinc finger

IPR007087 1083 1111 PS50157 Zinc finger

IPR007087 1231 1259 PS50157 Zinc finger

IPR007087 1292 1314 PS50157 Zinc finger

ScanRegExp IPR007087 813 835 PS00028 Zinc finger

IPR007087 872 893 PS00028 Zinc finger

IPR007087 900 921 PS00028 Zinc finger

IPR007087 935 955 PS00028 Zinc finger

IPR007087 966 987 PS00028 Zinc finger

IPR007087 1055 1076 PS00028 Zinc finger

IPR007087 1085 1106 PS00028 Zinc finger

IPR007087 1233 1254 PS00028 Zinc finger

IPR007087 1294 1314 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	870	893	PF00096	Zinc finger
IPR007087	898	921	PF00096	Zinc finger
IPR007087	933	955	PF00096	Zinc finger
IPR007087	964	987	PF00096	Zinc finger
IPR007087	1083	1106	PF00096	Zinc finger
IPR007087	1231	1254	PF00096	Zinc finger
IPR007087	1292	1314	PF00096	Zinc finger
HMMSmart	IPR015880	644	664	SM00355	Zinc finger
IPR015880	672	696	SM00355	Zinc finger
IPR015880	782	802	SM00355	Zinc finger
IPR015880	811	833	SM00355	Zinc finger
IPR015880	839	863	SM00355	Zinc finger
IPR015880	870	893	SM00355	Zinc finger
IPR015880	898	921	SM00355	Zinc finger
IPR015880	933	955	SM00355	Zinc finger
IPR015880	964	987	SM00355	Zinc finger
IPR015880	1053	1076	SM00355	Zinc finger
IPR015880	1083	1106	SM00355	Zinc finger
IPR015880	1113	1139	SM00355	Zinc finger
IPR015880	1202	1224	SM00355	Zinc finger
IPR015880	1231	1254	SM00355	Zinc finger
IPR015880	1292	1314	SM00355	Zinc finger
ProfileScan	IPR007087	644	662	PS50157	Zinc finger
IPR007087	782	812	PS50157	Zinc finger
IPR007087	898	926	PS50157	Zinc finger
IPR007087	933	960	PS50157	Zinc finger
IPR007087	964	992	PS50157	Zinc finger
IPR007087	1083	1111	PS50157	Zinc finger
IPR007087	1231	1259	PS50157	Zinc finger
IPR007087	1292	1314	PS50157	Zinc finger
ScanRegExp	IPR007087	813	835	PS00028	Zinc finger
IPR007087	872	893	PS00028	Zinc finger
IPR007087	900	921	PS00028	Zinc finger
IPR007087	935	955	PS00028	Zinc finger
IPR007087	966	987	PS00028	Zinc finger
IPR007087	1055	1076	PS00028	Zinc finger
IPR007087	1085	1106	PS00028	Zinc finger
IPR007087	1233	1254	PS00028	Zinc finger
IPR007087	1294	1314	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: CCR
Primer_f	: CTGAAGAGTTTGATGACGACG
Primer_r	: CACATTGCCTGACGTAGAGAG
PCR product length	: 182 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1477 bp
Genome contig ID	gi51511735f_54583680
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ACACATTTCATATGTAAATAAACGTGGGACATTTG
Flanking genome sequence (220478 - 220527)	----+--------+--------+--------+--------+----* GCCCTTGTGCTTCTGTGAGAGAATTATTGATGGTGGGTCTCTGACATCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	54681688	54804156	11	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1629

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information