HUGE |
Gene/Protein Characteristic Table for KIAA1629 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK07492 |
---|---|
Accession No. : | AB046849 |
Description : | zinc finger protein 532. |
HUGO Gene Name : | |
Clone Name : | fh20517 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fh14869, former representative clones for KIAA1629 with fh20517. (2001/2/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5595 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1477 bp Genome contig ID gi51511735f_54583680 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
ACACATTTCATATGTAAATAAACGTGGGACATTTGFlanking genome sequence
(220478 - 220527) ----+----*----+----*----+----*----+----*----+----*
GCCCTTGTGCTTCTGTGAGAGAATTATTGATGGTGGGTCTCTGACATCTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 f 54681688 54804156 11 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1329 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 18 |
: CCR | |
: CTGAAGAGTTTGATGACGACG | |
: CACATTGCCTGACGTAGAGAG | |
: 182 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |