HUGE

Gene/Protein Characteristic Table for KIAA0213

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05920
Accession No. :	D86968
Description :	Mitogen-activated protein kinase kinase kinase 4.
HUGO Gene Name :	mitogen-activated protein kinase kinase kinase 4 (MAP3K4)
Clone Name :	ha04841s1 [Vector Info]
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha04841, former representative clones for KIAA0213 with ha04841s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 5396 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 514 bp

Genome contig ID gi89161210f_161232749
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
CTTTTTTCAATAAATGGTTTATTTTAGGAAAGCTC
Flanking genome sequence
(225659 - 225708)
----+----*----+----*----+----*----+----*----+----*
AGTTATATTGTCTTTTAATGGTTAACACTTATGAGCCAACGCAGTATGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 161332749 161458406 26 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1626 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW47586	100.0	mitogen-activat...	Homo sapiens
AAI46771	99.9	Mitogen-activat...	Homo sapiens
CAH70639	99.9	mitogen-activat...	Homo sapiens
XP_862916	93.7	similar to mito...	Canis lupus fam...
AAC53127	89.2	MEK kinase 4b [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86959	9.8e-10	35.6	KIAA0204
AB032968	8.2e-08	29.8	KIAA1142
AB067488	8.2e-08	30.0	KIAA1901
AB037782	8.9e-08	33.2	KIAA1361
AB033090	1.2e-07	33.7	KIAA1264

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 1367 1607 PD000001 Protein kinase

HMMPfam IPR000719 1361 1619 PF00069 Protein kinase

HMMSmart IPR001245 1361 1619 SM00219 Tyrosine protein kinase

IPR002290 1361 1619 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 1361 1619 PS50011 Protein kinase

ScanRegExp IPR000719 1367 1390 PS00107 Protein kinase

IPR008271 1477 1489 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1367	1607	PD000001	Protein kinase
HMMPfam	IPR000719	1361	1619	PF00069	Protein kinase
HMMSmart	IPR001245	1361	1619	SM00219	Tyrosine protein kinase
IPR002290	1361	1619	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1361	1619	PS50011	Protein kinase
ScanRegExp	IPR000719	1367	1390	PS00107	Protein kinase
IPR008271	1477	1489	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACTACTGTACACGGACCATCG
Primer_r	: TAAAAACAAGGTATGGGACGC
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	514 bp
Genome contig ID	gi89161210f_161232749
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CTTTTTTCAATAAATGGTTTATTTTAGGAAAGCTC
Flanking genome sequence (225659 - 225708)	----+--------+--------+--------+--------+----* AGTTATATTGTCTTTTAATGGTTAACACTTATGAGCCAACGCAGTATGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	161332749	161458406	26	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0213

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information