HUGE

Gene/Protein Characteristic Table for KIAA0234

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00039
Accession No. :	D87072
Description :	Histone demethylase JARID1D.
HUGO Gene Name :	jumonji, AT rich interactive domain 1D (JARID1D)
Clone Name :	ha02764 [Vector Info]
Flexi ORF Clone :	pF1KA0234
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5134 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 575 bp

Genome contig ID gi89161220r_20226694
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TGTTAAAAATAAAACAATGAGTATGTTTGGATACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGAATATGATTTGAACTTCTTAAATTGTACGAGTGAAGGACTGAGGTTA

Features of the protein sequence	Description

Length: 1512 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW54663	100.0	Smcy homolog, Y...	Homo sapiens
Q9BY66	96.3	Histone demethy...	Homo sapiens
AAC50806	96.0	SMCY.	Homo sapiens
Q5XUN4	95.1	Histone demethy...	Pan troglodytes
ACL51656	88.2	jumonji AT-rich...	Callithrix jacchus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014577	1.3e-16	33.6	KIAA0677
AB018323	5.4e-16	33.2	KIAA0780
AB020683	1e-15	33.9	KIAA0876
AB040975	1.8e-06	45.2	KIAA1542
AB040909	1.9e-05	23.3	KIAA1476

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003349 45 89 PF02375 Transcription factor jumonji

IPR001606 106 202 PF01388 AT-rich interaction region

IPR001965 289 337 PF00628 Zinc finger

IPR013129 464 580 PF02373 Transcription factor jumonji

IPR004198 670 723 PF02928 Zinc finger

IPR013637 734 1060 PF08429 PLU-1-like

IPR001965 1147 1210 PF00628 Zinc finger

HMMSmart IPR003349 43 84 SM00545 Transcription factor jumonji

IPR001965 289 335 SM00249 Zinc finger

IPR003347 431 597 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase

IPR001965 1147 1208 SM00249 Zinc finger

ProfileScan IPR003349 44 85 PS51183 Transcription factor jumonji

IPR001965 287 337 PS50016 Zinc finger

IPR003347 431 597 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase

ScanRegExp IPR001965 290 334 PS01359 Zinc finger

IPR001965 1148 1207 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	45	89	PF02375	Transcription factor jumonji
IPR001606	106	202	PF01388	AT-rich interaction region
IPR001965	289	337	PF00628	Zinc finger
IPR013129	464	580	PF02373	Transcription factor jumonji
IPR004198	670	723	PF02928	Zinc finger
IPR013637	734	1060	PF08429	PLU-1-like
IPR001965	1147	1210	PF00628	Zinc finger
HMMSmart	IPR003349	43	84	SM00545	Transcription factor jumonji
IPR001965	289	335	SM00249	Zinc finger
IPR003347	431	597	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
IPR001965	1147	1208	SM00249	Zinc finger
ProfileScan	IPR003349	44	85	PS51183	Transcription factor jumonji
IPR001965	287	337	PS50016	Zinc finger
IPR003347	431	597	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase
ScanRegExp	IPR001965	290	334	PS01359	Zinc finger
IPR001965	1148	1207	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: Y

Experimental conditions

Panel name	: CCR
Primer_f	: ACCCCGATGCTCAGAAGTGTC
Primer_r	: TACAGAAAGAGGGTGGTGGGG
PCR product length	: 157 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	575 bp
Genome contig ID	gi89161220r_20226694
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TGTTAAAAATAAAACAATGAGTATGTTTGGATACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGAATATGATTTGAACTTCTTAAATTGTACGAGTGAAGGACTGAGGTTA

Gene/Protein Characteristic Table for KIAA0234

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information