HUGE |
Gene/Protein Characteristic Table for KIAA0876 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00669 |
---|---|
Accession No. : | AB020683 |
Description : | JmjC domain-containing histone demethylation protein 3B. |
HUGO Gene Name : | jumonji domain containing 2B (JMJD2B) |
Clone Name : | hh03683 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0876
![]() |
Source : | Human adult brain |
Note : | We replaced hk07354, former representative clones for KIAA0876 with hh03683. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5595 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2086 bp Genome contig ID gi42406306f_4820132 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
GGTTCATAATGAATTAAAGGTTCATGAACGCTGCGFlanking genome sequence
(284476 - 284525) ----+----*----+----*----+----*----+----*----+----*
AAACCCCGTTCCATGCCCCGGCAAGTGTCTTCATTTCTGAGCCTGTGCTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 4920132 5104606 23 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1119 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GCCCTTCTGGTTGGTAGTGAG | |
: TTCTCTATCAGCTCAACCCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: GeneBridge 4 | |
: GCCCTTCTGGTTGGTAGTGAG | |
: TTCTCTATCAGCTCAACCCAC | |
: 212 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |