HUGE

Gene/Protein Characteristic Table for KIAA0876

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00669
Accession No. :	AB020683
Description :	JmjC domain-containing histone demethylation protein 3B.
HUGO Gene Name :	jumonji domain containing 2B (JMJD2B)
Clone Name :	hh03683 [Vector Info]
Flexi ORF Clone :	pF1KSDA0876
Source :	Human adult brain
Note :	We replaced hk07354, former representative clones for KIAA0876 with hh03683. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 5595 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2086 bp

Genome contig ID gi42406306f_4820132
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
GGTTCATAATGAATTAAAGGTTCATGAACGCTGCG
Flanking genome sequence
(284476 - 284525)
----+----*----+----*----+----*----+----*----+----*
AAACCCCGTTCCATGCCCCGGCAAGTGTCTTCATTTCTGAGCCTGTGCTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 4920132 5104606 23 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1119 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW69181	100.0	jumonji domain ...	Homo sapiens
O94953	99.9	JmjC domain-con...	Homo sapiens
XP_001140503	99.5	jumonji domain ...	Pan troglodytes
XP_001083379	97.5	jumonji domain ...	Macaca mulatta
XP_533946	87.8	similar to Jumo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018323	2.8e-55	54.7	KIAA0780
AB014577	2.8e-51	50.9	KIAA0677
D87072	8.9e-08	33.9	KIAA0234
AB033112	4e-07	36.8	KIAA1286
D87076	6.3e-07	38.0	KIAA0239

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003349 39 84 PF02375 Transcription factor jumonji

IPR013129 199 315 PF02373 Transcription factor jumonji

IPR001965 780 814 PF00628 Zinc finger

HMMSmart IPR003349 37 79 SM00545 Transcription factor jumonji

IPR003347 166 332 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase

IPR001965 754 812 SM00249 Zinc finger

IPR001965 874 930 SM00249 Zinc finger

IPR002999 940 997 SM00333 Tudor

IPR002999 998 1054 SM00333 Tudor

ProfileScan IPR003349 38 80 PS51183 Transcription factor jumonji

IPR003347 169 332 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003349	39	84	PF02375	Transcription factor jumonji
IPR013129	199	315	PF02373	Transcription factor jumonji
IPR001965	780	814	PF00628	Zinc finger
HMMSmart	IPR003349	37	79	SM00545	Transcription factor jumonji
IPR003347	166	332	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
IPR001965	754	812	SM00249	Zinc finger
IPR001965	874	930	SM00249	Zinc finger
IPR002999	940	997	SM00333	Tudor
IPR002999	998	1054	SM00333	Tudor
ProfileScan	IPR003349	38	80	PS51183	Transcription factor jumonji
IPR003347	169	332	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCCTTCTGGTTGGTAGTGAG

Primer_r
: TTCTCTATCAGCTCAACCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCCCTTCTGGTTGGTAGTGAG
Primer_r	: TTCTCTATCAGCTCAACCCAC
PCR product length	: 212 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2086 bp
Genome contig ID	gi42406306f_4820132
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GGTTCATAATGAATTAAAGGTTCATGAACGCTGCG
Flanking genome sequence (284476 - 284525)	----+--------+--------+--------+--------+----* AAACCCCGTTCCATGCCCCGGCAAGTGTCTTCATTTCTGAGCCTGTGCTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	4920132	5104606	23	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0876

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information