HUGE |
Gene/Protein Characteristic Table for KIAA0239 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00474 |
---|---|
Accession No. : | D87076 |
Description : | Protein Jade-2. |
HUGO Gene Name : | PHD finger protein 15 (PHF15) |
Clone Name : | ha06313 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0239
![]() |
Source : | Human adult brain |
Note : | We replaced ha02778, former representative clones for KIAA0239 with ha06313. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6466 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3914 bp Genome contig ID gi51511721f_133789697 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
GGCAAACGCAGTTAATAAAGCAATGTTTTCTGTGCFlanking genome sequence
(157122 - 157171) ----+----*----+----*----+----*----+----*----+----*
TGGCTGGTGTGAGGCTCCATTGCATTGGATGGGGTAGGGAACCCTGGGAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 133889697 133946817 11 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 849 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 5 |
: Genebridge 4 | |
: TGCTACGGGATCCTCAAGGTG | |
: CAGCTGACATGCACCCACTTG | |
: 146 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |