HUGE

Gene/Protein Characteristic Table for KIAA0215

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00463
Accession No. :	D86969
Description :	Protein Jade-3.
HUGO Gene Name :	PHD finger protein 16 (PHF16)
Clone Name :	ha02776 [Vector Info]
Flexi ORF Clone :	pF1KSDA0215
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4935 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2165 bp

Genome contig ID gi89161218f_46556970
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TACCAATACTTTTTCATTAAATTATGAAAACTGCT
Flanking genome sequence
(248616 - 248665)
----+----*----+----*----+----*----+----*----+----*
ACCTACTGTCAGTGTGTTTTTTATTTTGGCATATTGGTTACACATGTTCC

Features of the protein sequence	Description

Length: 857 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001100171	99.0	PHD finger prot...	Macaca mulatta
Q92613	100.0	Protein Jade-3;...	Homo sapiens
BAF83909	99.8	unnamed protein...	Homo sapiens
XP_001491347	90.3	PHD finger prot...	Equus caballus
XP_538010	89.3	similar to PHD ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87076	7.9e-79	42.8	KIAA0239
AB058710	3.2e-55	45.1	KIAA1807
AB033112	7.6e-25	31.7	KIAA1286
AB020683	6.4e-13	40.1	KIAA0876
AB018323	7.8e-13	40.4	KIAA0780

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 236 284 PF00628 Zinc finger

HMMSmart IPR001965 236 282 SM00249 Zinc finger

IPR001965 345 400 SM00249 Zinc finger

ProfileScan IPR001965 234 284 PS50016 Zinc finger

ScanRegExp IPR001965 237 281 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	236	284	PF00628	Zinc finger
HMMSmart	IPR001965	236	282	SM00249	Zinc finger
IPR001965	345	400	SM00249	Zinc finger
ProfileScan	IPR001965	234	284	PS50016	Zinc finger
ScanRegExp	IPR001965	237	281	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACAGTGCTTCAGCCAAATTCC
Primer_r	: GAGCTTATCTTGGAAAACTGG
PCR product length	: 250 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2165 bp
Genome contig ID	gi89161218f_46556970
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TACCAATACTTTTTCATTAAATTATGAAAACTGCT
Flanking genome sequence (248616 - 248665)	----+--------+--------+--------+--------+----* ACCTACTGTCAGTGTGTTTTTTATTTTGGCATATTGGTTACACATGTTCC

Gene/Protein Characteristic Table for KIAA0215

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information