HUGE

Gene/Protein Characteristic Table for KIAA1286

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB033112
Description :	Bromodomain and PHD finger-containing protein 3.
HUGO Gene Name :	bromodomain and PHD finger containing, 3 (BRPF3)
Clone Name :	hh11961 [Vector Info]
Flexi ORF Clone :	pF1KA1286
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5876 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 2176 bp

Genome contig ID gi89161210f_36172590
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TATTTTCTCTCTGAGAAATAAATGTTCTAATGGGC
Flanking genome sequence
(135953 - 136002)
----+----*----+----*----+----*----+----*----+----*
AGTAGTTGCTGTGTTGTGTTTAATCAGTAGGGGCCTACCCCTGTCTTCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 36272528 36308541 13 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1214 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10446	100.0	bromodomain and...	synthetic construct
Q9ULD4	99.9	Bromodomain and...	Homo sapiens
EAX03880	99.7	bromodomain and...	Homo sapiens
XP_518433	99.5	bromodomain and...	Pan troglodytes
XP_538883	95.9	similar to Brom...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058710	7.3e-15	33.7	KIAA1807
D86969	1.1e-14	31.5	KIAA0215
D87076	5.2e-14	31.1	KIAA0239
AB020683	1.2e-07	36.5	KIAA0876
AB014577	6e-07	37.5	KIAA0677

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001487 632 648 PR00503 Bromodomain

IPR001487 648 666 PR00503 Bromodomain

IPR001487 666 685 PR00503 Bromodomain

HMMPfam IPR001965 223 271 PF00628 Zinc finger

IPR001487 603 690 PF00439 Bromodomain

IPR000313 1082 1182 PF00855 PWWP

HMMSmart IPR001965 223 269 SM00249 Zinc finger

IPR001965 333 396 SM00249 Zinc finger

IPR001487 596 704 SM00297 Bromodomain

IPR000313 1083 1166 SM00293 PWWP

ProfileScan IPR001965 221 271 PS50016 Zinc finger

IPR001487 615 685 PS50014 Bromodomain

IPR000313 1085 1168 PS50812 PWWP

ScanRegExp IPR001965 224 268 PS01359 Zinc finger

IPR001487 620 677 PS00633 Bromodomain

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	632	648	PR00503	Bromodomain
IPR001487	648	666	PR00503	Bromodomain
IPR001487	666	685	PR00503	Bromodomain
HMMPfam	IPR001965	223	271	PF00628	Zinc finger
IPR001487	603	690	PF00439	Bromodomain
IPR000313	1082	1182	PF00855	PWWP
HMMSmart	IPR001965	223	269	SM00249	Zinc finger
IPR001965	333	396	SM00249	Zinc finger
IPR001487	596	704	SM00297	Bromodomain
IPR000313	1083	1166	SM00293	PWWP
ProfileScan	IPR001965	221	271	PS50016	Zinc finger
IPR001487	615	685	PS50014	Bromodomain
IPR000313	1085	1168	PS50812	PWWP
ScanRegExp	IPR001965	224	268	PS01359	Zinc finger
IPR001487	620	677	PS00633	Bromodomain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATGATAGCAAACCTCCAAGC

Primer_r
: GATAGTCTGTTGATGCCATTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	2176 bp
Genome contig ID	gi89161210f_36172590
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATTTTCTCTCTGAGAAATAAATGTTCTAATGGGC
Flanking genome sequence (135953 - 136002)	----+--------+--------+--------+--------+----* AGTAGTTGCTGTGTTGTGTTTAATCAGTAGGGGCCTACCCCTGTCTTCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	36272528	36308541	13	99.6	Perfect prediction

Primer_f	: AATGATAGCAAACCTCCAAGC
Primer_r	: GATAGTCTGTTGATGCCATTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1286

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information