HUGE

Gene/Protein Characteristic Table for KIAA0783

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01995
Accession No. :	AB018326
Description :	PHD finger protein 14.
HUGO Gene Name :	PHD finger protein 14 (PHF14)
Clone Name :	hk05408 [Vector Info]
Flexi ORF Clone :	pF1KA0783
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4231 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1157 bp

Genome contig ID gi89161213f_10880069
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AATTTTCTGATTAATAAATGTGGTTTTGGACATCT
Flanking genome sequence
(229740 - 229789)
----+----*----+----*----+----*----+----*----+----*
TTTCGGGTATAGTGACAATGGAAAATAGTTTAAACTTTAGGAATAGAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 10980069 11109807 17 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 899 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O94880	100.0	PHD finger prot...	Homo sapiens
NP_055475	99.9	PHD finger prot...	Homo sapiens
EAW93636	100.0	PHD finger prot...	Homo sapiens
NP_001007158	99.9	PHD finger prot...	Homo sapiens
XP_001084293	99.3	PHD finger prot...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87076	2.3e-07	25.0	KIAA0239
AB058710	3.6e-07	27.7	KIAA1807
AB033112	0.0001	25.5	KIAA1286
AB014577	0.00024	31.4	KIAA0677
AB020683	0.00025	30.1	KIAA0876

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 332 391 PF00628 Zinc finger

IPR001965 738 790 PF00628 Zinc finger

HMMSmart IPR001965 332 389 SM00249 Zinc finger

IPR001965 451 510 SM00249 Zinc finger

IPR001965 738 788 SM00249 Zinc finger

ProfileScan IPR001965 330 391 PS50016 Zinc finger

IPR001965 736 790 PS50016 Zinc finger

ScanRegExp IPR001965 333 388 PS01359 Zinc finger

IPR001965 739 787 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	332	391	PF00628	Zinc finger
IPR001965	738	790	PF00628	Zinc finger
HMMSmart	IPR001965	332	389	SM00249	Zinc finger
IPR001965	451	510	SM00249	Zinc finger
IPR001965	738	788	SM00249	Zinc finger
ProfileScan	IPR001965	330	391	PS50016	Zinc finger
IPR001965	736	790	PS50016	Zinc finger
ScanRegExp	IPR001965	333	388	PS01359	Zinc finger
IPR001965	739	787	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATACCCTTCATGAGACCCAAC

Primer_r
: TTCTATCCAAACCTGACAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1157 bp
Genome contig ID	gi89161213f_10880069
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATTTTCTGATTAATAAATGTGGTTTTGGACATCT
Flanking genome sequence (229740 - 229789)	----+--------+--------+--------+--------+----* TTTCGGGTATAGTGACAATGGAAAATAGTTTAAACTTTAGGAATAGAGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	10980069	11109807	17	99.8	Perfect prediction

Primer_f	: ATACCCTTCATGAGACCCAAC
Primer_r	: TTCTATCCAAACCTGACAAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0783

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information