HUGE |
Gene/Protein Characteristic Table for KIAA0237 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00472 |
---|---|
Accession No. : | D87074 |
Description : | Regulating synaptic membrane exocytosis protein 3. |
HUGO Gene Name : | potassium channel, subfamily K, member 15 (KCNK15) |
Clone Name : | ha06286 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0237
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7239 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 5837 bp Genome contig ID gi89161185r_40758939 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
GCAGCAAAACATGATTAAAGTCAGTTTGAAAATGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TTTCATGTGTTGCTTTCTGTAGATGGTTCTTCATTCTAGAAGGAAGAAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 40858939 40903919 8 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 315 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 1 |
: Genebridge 4 | |
: ACTTGTTGTGGTTCCCGGGTG | |
: CTGCCCAAATACTGTACATGC | |
: 130 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |