HUGE |
Gene/Protein Characteristic Table for KIAA1228 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04976 |
---|---|
Accession No. : | AB033054 |
Description : | Protein FAM62B. |
HUGO Gene Name : | family with sequence similarity 62 (C2 domain containing) member B (FAM62B) |
Clone Name : | fh05620s1 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fh05620, former representative clones for KIAA1228 with fh05620s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5742 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3208 bp Genome contig ID gi89161213r_158116450 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CATGTATTTATTCAATAAAACCTTTATGTTAGCTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTCGTGATTTGTTTTTCTCTGTCTTTTGAAGGGAGGTGTTCAGTGTGCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 158216450 158314949 23 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 843 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ATCTATAAAGCAGCAGCACTC | |
: ATTGTGTCTACTCTGCCTAAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |