HUGE

Gene/Protein Characteristic Table for KIAA0280

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00492
Accession No. :	D87470
Description :
HUGO Gene Name :	family with sequence similarity 168, member B (FAM168B)
Clone Name :	ha06179 [Vector Info]
Flexi ORF Clone :	pF1KSDA0280
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6837 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5960 bp

Genome contig ID gi51511727r_72689513
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
ACACTCAATAACTATTAAAAAAAAAATTCCCCCCC
Flanking genome sequence
(99980 - 99931)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAGTCTTAGGTGACTAGACTGAGTGGTTCTTGGGGAGGGAGGCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 72789493 72986739 9 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 291 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDM18313	1.5e-79	99.6	LOC361614 (pred...	Rattus norvegicus
EDM18315	9.3e-66	99.5	LOC361614 (pred...	Rattus norvegicus
XP_001505420	1.7e-64	82.4	hypothetical pr...	Ornithorhynchus...
BAC33374	1.5e-61	96.3	unnamed protein...	Mus musculus
EDM18314	1.5e-61	95.9	LOC361614 (pred...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GGATCTATGGTGTGACTCAAG
Primer_r	: TATGAAACAGGGAAGCAGATG
PCR product length	: 145 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5960 bp
Genome contig ID	gi51511727r_72689513
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACACTCAATAACTATTAAAAAAAAAATTCCCCCCC
Flanking genome sequence (99980 - 99931)	----+--------+--------+--------+--------+----* AAAAAAAAGTCTTAGGTGACTAGACTGAGTGGTTCTTGGGGAGGGAGGCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	72789493	72986739	9	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0280

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information