HUGE

Gene/Protein Characteristic Table for KIAA0290

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00498
Accession No. :	AB006628
Description :	FCH domain only protein 1.
HUGO Gene Name :	FCH domain only 1 (FCHO1)
Clone Name :	ha06644 [Vector Info]
Flexi ORF Clone :	pF1KSDA0290
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2979 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 256 bp

Genome contig ID gi42406306f_17626926
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CTTTATTTTCTAATAAAATAAAAAAGGAAACCTTT
Flanking genome sequence
(133447 - 133496)
----+----*----+----*----+----*----+----*----+----*
TCCTGCTCCAGGAAGTATCCTTTGCGTTGCCAGAGAGGGGAGGAAGAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 17726919 17760371 26 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 906 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O14526	100.0	FCH domain only...	Homo sapiens
AAH28021	99.3	FCHO1 protein [...	Homo sapiens
BAG64632	100.0	unnamed protein...	Homo sapiens
BAH14829	99.9	unnamed protein...	Homo sapiens
XP_533878	93.4	similar to FCH ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001060 23 109 PF00611 Cdc15/Fes/CIP4

HMMSmart IPR001060 23 109 SM00055 Cdc15/Fes/CIP4

ProfileScan IPR001060 19 100 PS50133 Cdc15/Fes/CIP4

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001060	23	109	PF00611	Cdc15/Fes/CIP4
HMMSmart	IPR001060	23	109	SM00055	Cdc15/Fes/CIP4
ProfileScan	IPR001060	19	100	PS50133	Cdc15/Fes/CIP4

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTCCAGATGTGTCCGAGGCAG
Primer_r	: CCTGTGGCAAACCTCCTCTTC
PCR product length	: 190 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	256 bp
Genome contig ID	gi42406306f_17626926
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTTTATTTTCTAATAAAATAAAAAAGGAAACCTTT
Flanking genome sequence (133447 - 133496)	----+--------+--------+--------+--------+----* TCCTGCTCCAGGAAGTATCCTTTGCGTTGCCAGAGAGGGGAGGAAGAGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	17726919	17760371	26	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0290

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information