HUGE

Gene/Protein Characteristic Table for KIAA0306

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04567
Accession No. :	AB002304
Description :	Protein capicua homolog.
HUGO Gene Name :	capicua homolog (Drosophila) (CIC)
Clone Name :	hg00063 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4964 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1451 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK73515	100.0	capicua protein...	Homo sapiens
AAD11988	99.9	BC85722_1 [Homo...	Homo sapiens
EAW57121	99.9	capicua homolog...	Homo sapiens
Q96RK0	99.9	Protein capicua...	Homo sapiens
XP_001153776	99.6	capicua homolog...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	1.3e-05	29.0	KIAA0309
AB040955	0.00013	26.0	KIAA1522

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan NULL 935 947 PR01217 NULL

NULL 969 981 PR01217 NULL

NULL 989 1010 PR01217 NULL

NULL 1042 1059 PR01217 NULL

NULL 1068 1093 PR01217 NULL

HMMPfam IPR000910 43 111 PF00505 HMG1/2 (high mobility group) box

HMMSmart IPR000910 42 112 SM00398 HMG1/2 (high mobility group) box

ProfileScan IPR000910 43 111 PS50118 HMG1/2 (high mobility group) box

ScanRegExp IPR002345 70 83 PS00213 Lipocalin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	935	947	PR01217	NULL
NULL	969	981	PR01217	NULL
NULL	989	1010	PR01217	NULL
NULL	1042	1059	PR01217	NULL
NULL	1068	1093	PR01217	NULL
HMMPfam	IPR000910	43	111	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR000910	42	112	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR000910	43	111	PS50118	HMG1/2 (high mobility group) box
ScanRegExp	IPR002345	70	83	PS00213	Lipocalin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CAGAGGGGGTGAGGAGAAAAC

Primer_r
: GCACCCCTTTTTTCCCCAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: CCR
Primer_f	: CAGAGGGGGTGAGGAGAAAAC
Primer_r	: GCACCCCTTTTTTCCCCAGAG
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0306

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information