HUGE

Gene/Protein Characteristic Table for KIAA0393

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB002391
Description :	Probable E3 ubiquitin-protein ligase HERC2.
HUGO Gene Name :
Clone Name :	hg01266 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6067 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES NO

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 1187 bp

Genome contig ID gi51511731f_26556279
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GTTTACAAGTAATAAAAATTTTATCTCCAATTTTC
Flanking genome sequence
(173172 - 173221)
----+----*----+----*----+----*----+----*----+----*
AATAATTACACCCATTATTTCTGTTTTATGTCTCATTGCATTGATGAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 26656279 26729449 32 98.5 Perfect prediction

Features of the protein sequence	Description

Length: 1433 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW57668	95.9	hCG2006901, iso...	Homo sapiens
EAW57666	95.9	hCG2006901, iso...	Homo sapiens
NP_004658	95.8	hect domain and...	Homo sapiens
O95714	95.5	Probable E3 ubi...	Homo sapiens
XP_001109429	95.1	similar to hect...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032957	2.8e-10	40.1	KIAA1131

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001199 20 98 PD000612 Cytochrome b5

HMMPfam IPR001199 17 91 PF00173 Cytochrome b5

IPR010606 679 741 PF06701 Mib_herc2

ProfileScan IPR001199 15 91 PS50255 Cytochrome b5

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001199	20	98	PD000612	Cytochrome b5
HMMPfam	IPR001199	17	91	PF00173	Cytochrome b5
IPR010606	679	741	PF06701	Mib_herc2
ProfileScan	IPR001199	15	91	PS50255	Cytochrome b5

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AAGAAGCAGGAGAGATGGAGC

Primer_r
: TCTGCCAAAGGAAGCCCCGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGAAGCAGGAGAGATGGAGC
Primer_r	: TCTGCCAAAGGAAGCCCCGTG
PCR product length	: 135 bp
PCR conditions	: 95 °C15 sec68 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	NO
Warning for coding interruption:	YES	YES

Length of 3'UTR	1187 bp
Genome contig ID	gi51511731f_26556279
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTTTACAAGTAATAAAAATTTTATCTCCAATTTTC
Flanking genome sequence (173172 - 173221)	----+--------+--------+--------+--------+----* AATAATTACACCCATTATTTCTGTTTTATGTCTCATTGCATTGATGAGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	26656279	26729449	32	98.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0393

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information