HUGE

Gene/Protein Characteristic Table for KIAA1131

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05410
Accession No. :	AB032957
Description :	E3 ubiquitin-protein ligase HECTD1.
HUGO Gene Name :	HECT domain containing 1 (HECTD1)
Clone Name :	pf08614 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced hh01054, former representative clones for KIAA1131 with pf08614. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7320 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 812 bp

Genome contig ID gi51511730r_30539075
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
ATGCTCAACAATAATCATTAAAATGTTTGCAGCGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAGAACTGTGTCATGTGACTATTTCAATGCAGTCATCAGACTTAAGAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 30639075 30708431 35 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 2168 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW65950	100.0	HECT domain con...	Homo sapiens
NP_056197	99.9	HECT domain con...	Homo sapiens
XP_001489913	99.7	HECT domain con...	Equus caballus
NP_659037	98.8	HECT domain con...	Mus musculus
XP_001114983	99.3	similar to HECT...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D28476	7.2e-18	30.4	KIAA0045
AB037741	2e-11	32.9	KIAA1320
D13635	3.1e-10	32.7	KIAA0010
AB007899	3.5e-10	32.4	KIAA0439
AB002310	1e-08	33.3	KIAA0312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 18 30 PR01415 Ankyrin

IPR002110 30 42 PR01415 Ankyrin

HMMPfam IPR002110 1 16 PF00023 Ankyrin

IPR002110 17 52 PF00023 Ankyrin

IPR012919 665 798 PF07738 Sad1/UNC-like

IPR010606 835 896 PF06701 Mib_herc2

IPR000569 1737 2168 PF00632 HECT

HMMSmart IPR000569 1701 2168 SM00119 HECT

ProfileScan IPR002110 1 41 PS50297 Ankyrin

IPR000569 1709 2168 PS50237 HECT

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	18	30	PR01415	Ankyrin
IPR002110	30	42	PR01415	Ankyrin
HMMPfam	IPR002110	1	16	PF00023	Ankyrin
IPR002110	17	52	PF00023	Ankyrin
IPR012919	665	798	PF07738	Sad1/UNC-like
IPR010606	835	896	PF06701	Mib_herc2
IPR000569	1737	2168	PF00632	HECT
HMMSmart	IPR000569	1701	2168	SM00119	HECT
ProfileScan	IPR002110	1	41	PS50297	Ankyrin
IPR000569	1709	2168	PS50237	HECT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCTCAAGAGCAATAGTATGG

Primer_r
: ATTCTCAGCCCATTCCATCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTTTTAATGATGGCCTGCAC
Primer_r	: GCACTTAGACCAGGTTTTCCC
PCR product length	: 204 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	812 bp
Genome contig ID	gi51511730r_30539075
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- ATGCTCAACAATAATCATTAAAATGTTTGCAGCGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAGAACTGTGTCATGTGACTATTTCAATGCAGTCATCAGACTTAAGAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	30639075	30708431	35	99.9	Perfect prediction

Primer_f	: GCCTCAAGAGCAATAGTATGG
Primer_r	: ATTCTCAGCCCATTCCATCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1131

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information