HUGE

Gene/Protein Characteristic Table for KIAA0010

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01048
Accession No. :	D13635
Description :	Ubiquitin-protein ligase E3C.
HUGO Gene Name :	ubiquitin protein ligase E3C (UBE3C)
Clone Name :	ha00408 [Vector Info]
Flexi ORF Clone :	pF1KA0010
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5160 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1605 bp

Genome contig ID gi89161213f_156524425
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
ATGGCTAAACATTTACATTAAATATTTTTTTTCCC
Flanking genome sequence
(230400 - 230449)
----+----*----+----*----+----*----+----*----+----*
AAGATTGTGTTGGAGTCCTACCCCAAATCATTGTGATTAGCACAGCTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 156624425 156754823 23 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1086 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11121	100.0	ubiquitin-prote...	synthetic construct
Q15386	99.9	Ubiquitin-prote...	Homo sapiens
XP_528010	98.7	ubiquitin prote...	Pan troglodytes
XP_539937	95.3	similar to Ubiq...	Canis lupus fam...
Q80U95	93.3	Ubiquitin-prote...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007899	1.2e-32	32.3	KIAA0439
AB002310	1.4e-32	32.6	KIAA0312
D42055	1.7e-31	31.8	KIAA0093
AB046845	4.1e-31	31.7	KIAA1625
AB037741	6.2e-30	32.0	KIAA1320

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000048 49 69 PF00612 IQ calmodulin-binding region

IPR000569 781 1086 PF00632 HECT

HMMSmart IPR000048 47 69 SM00015 IQ calmodulin-binding region

IPR000569 745 1086 SM00119 HECT

ProfileScan IPR000048 48 77 PS50096 IQ calmodulin-binding region

IPR000569 747 1086 PS50237 HECT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	49	69	PF00612	IQ calmodulin-binding region
IPR000569	781	1086	PF00632	HECT
HMMSmart	IPR000048	47	69	SM00015	IQ calmodulin-binding region
IPR000569	745	1086	SM00119	HECT
ProfileScan	IPR000048	48	77	PS50096	IQ calmodulin-binding region
IPR000569	747	1086	PS50237	HECT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TCATCCGCTCGCCCTCCTTT
Primer_r	: ACTGCAAGAACTACCGACAC
PCR product length	: 169 bp
PCR conditions	: 95 °C15 sec58 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1605 bp
Genome contig ID	gi89161213f_156524425
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- ATGGCTAAACATTTACATTAAATATTTTTTTTCCC
Flanking genome sequence (230400 - 230449)	----+--------+--------+--------+--------+----* AAGATTGTGTTGGAGTCCTACCCCAAATCATTGTGATTAGCACAGCTTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	156624425	156754823	23	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0010

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information