HUGE |
Gene/Protein Characteristic Table for KIAA1320 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05390 |
---|---|
Accession No. : | AB037741 |
Description : | E3 ubiquitin-protein ligase HACE1. |
HUGO Gene Name : | HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 (HACE1) |
Clone Name : | fh13757 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5321 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1567 bp Genome contig ID gi89161210r_105182663 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
GTAAAAGAGATAGATAATAAAATATTAAATAACTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTGTGGTGGCTTATGTCTGTAATCTCAGCATTTCGAGAGGCTGAGGTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 105282663 105341982 13 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 567 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTGTGCCATATACTCCAAATC | |
: ATTGTGCATCAGTAGTCAGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |