HUGE

Gene/Protein Characteristic Table for KIAA1320

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05390
Accession No. :	AB037741
Description :	E3 ubiquitin-protein ligase HACE1.
HUGO Gene Name :	HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 (HACE1)
Clone Name :	fh13757 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5321 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1567 bp

Genome contig ID gi89161210r_105182663
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTAAAAGAGATAGATAATAAAATATTAAATAACTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTGTGGTGGCTTATGTCTGTAATCTCAGCATTTCGAGAGGCTGAGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 105282663 105341982 13 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 567 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH71889	100.0	HECT domain and...	Homo sapiens
CAH71890	99.8	HECT domain and...	Homo sapiens
Q8IYU2	99.8	E3 ubiquitin-pr...	Homo sapiens
BAE00393	99.5	unnamed protein...	Macaca fascicularis
XP_001142834	99.6	HECT domain and...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002310	4.5e-55	37.2	KIAA0312
AB007899	6.5e-54	42.6	KIAA0439
D42055	3.3e-52	41.3	KIAA0093
AB046845	2.2e-50	42.2	KIAA1625
AB002320	4e-49	41.7	KIAA0322

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000569 260 567 PF00632 HECT

HMMSmart IPR000569 230 567 SM00119 HECT

ProfileScan IPR000569 232 567 PS50237 HECT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000569	260	567	PF00632	HECT
HMMSmart	IPR000569	230	567	SM00119	HECT
ProfileScan	IPR000569	232	567	PS50237	HECT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGTGCCATATACTCCAAATC

Primer_r
: ATTGTGCATCAGTAGTCAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1567 bp
Genome contig ID	gi89161210r_105182663
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTAAAAGAGATAGATAATAAAATATTAAATAACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGTGGTGGCTTATGTCTGTAATCTCAGCATTTCGAGAGGCTGAGGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	105282663	105341982	13	99.5	Perfect prediction

Primer_f	: CTGTGCCATATACTCCAAATC
Primer_r	: ATTGTGCATCAGTAGTCAGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1320

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information