HUGE

Gene/Protein Characteristic Table for KIAA0397

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01082
Accession No. :	AB007857
Description :	RUN and TBC1 domain containing 1 isoform 1.
HUGO Gene Name :	small G protein signaling modulator 2 (SGSM2)
Clone Name :	fj00010 [Vector Info]
Flexi ORF Clone :	pF1KA0397
Source :	Human fetal brain
Note :	We replaced hg00184, former representative clones for KIAA0397 with fj00010. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4734 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1538 bp

Genome contig ID gi51511734f_2087639
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GTAACAGACCAATAAACAACATTTGTCAACACTGG
Flanking genome sequence
(143465 - 143514)
----+----*----+----*----+----*----+----*----+----*
AGCCTCTGGGACTGGACACTGAGAGACCACGTGCCTTCTTTAAGCTCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 2187558 2231102 23 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1016 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O43147	100.0	Small G protein...	Homo sapiens
EAW90547	99.8	RUN and TBC1 do...	Homo sapiens
EAW90545	99.6	RUN and TBC1 do...	Homo sapiens
BAG58030	99.9	unnamed protein...	Homo sapiens
EDM05191	93.0	RUN and TBC1 do...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075821	1.4e-56	50.8	KIAA1941
AB037743	0.00039	26.0	KIAA1322

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004012 52 199 PF02759 RUN

IPR000195 768 975 PF00566 RabGAP/TBC

HMMSmart IPR004012 138 198 SM00593 RUN

IPR000195 573 976 SM00164 RabGAP/TBC

ProfileScan IPR004012 44 201 PS50826 RUN

IPR000195 576 949 PS50086 RabGAP/TBC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	52	199	PF02759	RUN
IPR000195	768	975	PF00566	RabGAP/TBC
HMMSmart	IPR004012	138	198	SM00593	RUN
IPR000195	573	976	SM00164	RabGAP/TBC
ProfileScan	IPR004012	44	201	PS50826	RUN
IPR000195	576	949	PS50086	RabGAP/TBC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCTGCTCCTCACAAAACCACG

Primer_r
: ATTGTCCATCCTTGTTGTCCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCTGCTCCTCACAAAACCACG
Primer_r	: ATTGTCCATCCTTGTTGTCCG
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1538 bp
Genome contig ID	gi51511734f_2087639
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTAACAGACCAATAAACAACATTTGTCAACACTGG
Flanking genome sequence (143465 - 143514)	----+--------+--------+--------+--------+----* AGCCTCTGGGACTGGACACTGAGAGACCACGTGCCTTCTTTAAGCTCCAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	2187558	2231102	23	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0397

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information