HUGE

Gene/Protein Characteristic Table for KIAA1322

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00802
Accession No. :	AB037743
Description :	TBC1 domain family member 14.
HUGO Gene Name :	TBC1 domain family, member 14 (TBC1D14)
Clone Name :	fh13826 [Vector Info]
Flexi ORF Clone :	pF1KSDA1322
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4832 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2721 bp

Genome contig ID gi89161207f_6875999
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TGGTTTTATTAAATAAAAGTCAATGTAAAATTGTT
Flanking genome sequence
(209744 - 209793)
----+----*----+----*----+----*----+----*----+----*
ACTTATGTTCACCATCGTTTGTTTAAAGTTGAAGTTCTCACTTTGAGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 6975999 7085741 13 99.3 Terminal No-hit

Features of the protein sequence	Description

Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_526514	99.7	TBC1 domain fam...	Pan troglodytes
XP_001118829	98.9	similar to TBC1...	Macaca mulatta
BAG10032	100.0	TBC1 domain fam...	synthetic construct
Q9P2M4	99.9	TBC1 domain fam...	Homo sapiens
AAH41167	99.9	TBC1 domain fam...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011180	1.4e-93	70.6	KIAA0608
D13644	7.7e-10	26.9	KIAA0019
AB029031	6.1e-09	20.8	KIAA1108
AB011175	1.3e-08	21.2	KIAA0603
AB028978	5.9e-07	23.4	KIAA1055

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000195 409 641 PF00566 RabGAP/TBC

HMMSmart IPR000195 407 643 SM00164 RabGAP/TBC

ProfileScan IPR000195 410 620 PS50086 RabGAP/TBC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	409	641	PF00566	RabGAP/TBC
HMMSmart	IPR000195	407	643	SM00164	RabGAP/TBC
ProfileScan	IPR000195	410	620	PS50086	RabGAP/TBC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTGTTGGCAAGTGTAGAGGC

Primer_r
: TGTGAAGTGGAGTGTGCAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCTGTTGGCAAGTGTAGAGGC
Primer_r	: TGTGAAGTGGAGTGTGCAGAC
PCR product length	: 103 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2721 bp
Genome contig ID	gi89161207f_6875999
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TGGTTTTATTAAATAAAAGTCAATGTAAAATTGTT
Flanking genome sequence (209744 - 209793)	----+--------+--------+--------+--------+----* ACTTATGTTCACCATCGTTTGTTTAAAGTTGAAGTTCTCACTTTGAGCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	6975999	7085741	13	99.3	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1322

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information