HUGE |
Gene/Protein Characteristic Table for KIAA1941 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06809 |
---|---|
Accession No. : | AB075821 |
Description : | RUN and TBC1 domain-containing protein 2. |
HUGO Gene Name : | small G protein signaling modulator 1 (SGSM1) |
Clone Name : | ah04470 [Vector Info] |
Source : | Human brain (amygdala) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6029 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1082 bp Genome contig ID gi89161203f_23469427 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ACTCCAGCCCGGGCGACAGTTCAAGACTCCATCTCFlanking genome sequence
(181898 - 181947) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAAAAGGCACACAAGAGTCCCTCACACATCTCTCTTGGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 23569427 23651323 22 99.7 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1233 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACGAGTTCATGTCCATCACGG | |
: CTCGTTGGCAGAAGTAGTCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |