HUGE

Gene/Protein Characteristic Table for KIAA1941

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06809
Accession No. :	AB075821
Description :	RUN and TBC1 domain-containing protein 2.
HUGO Gene Name :	small G protein signaling modulator 1 (SGSM1)
Clone Name :	ah04470 [Vector Info]
Source :	Human brain (amygdala)

Features of the cloned DNA sequence	Description

Length: 6029 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1082 bp

Genome contig ID gi89161203f_23469427
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCCGGGCGACAGTTCAAGACTCCATCTC
Flanking genome sequence
(181898 - 181947)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGAAAAGGCACACAAGAGTCCCTCACACATCTCTCTTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 23569427 23651323 22 99.7 Internal No-hit

Features of the protein sequence	Description

Length: 1233 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH16622	0	100.0	RUN and TBC1 do...	Homo sapiens
NP_001091968	0	86.4	RUN and TBC1 do...	Homo sapiens
NP_597711	0	82.5	RUN and TBC1 do...	Homo sapiens
XP_001171390	0	82.2	RUN and TBC1 do...	Pan troglodytes
BAF63511	2.3e-188	82.1	small G protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007857	1.4e-60	50.5	KIAA0397
AB011180	5.8e-05	21.6	KIAA0608
AB028978	0.00016	25.1	KIAA1055
AB037743	0.00074	24.1	KIAA1322

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004012 87 231 PF02759 RUN

IPR004012 264 389 PF02759 RUN

IPR000195 1003 1192 PF00566 RabGAP/TBC

HMMSmart IPR004012 170 230 SM00593 RUN

IPR004012 332 388 SM00593 RUN

IPR000195 975 1193 SM00164 RabGAP/TBC

ProfileScan IPR004012 79 233 PS50826 RUN

IPR004012 254 391 PS50826 RUN

IPR000195 763 1166 PS50086 RabGAP/TBC

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	87	231	PF02759	RUN
IPR004012	264	389	PF02759	RUN
IPR000195	1003	1192	PF00566	RabGAP/TBC
HMMSmart	IPR004012	170	230	SM00593	RUN
IPR004012	332	388	SM00593	RUN
IPR000195	975	1193	SM00164	RabGAP/TBC
ProfileScan	IPR004012	79	233	PS50826	RUN
IPR004012	254	391	PS50826	RUN
IPR000195	763	1166	PS50086	RabGAP/TBC

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACGAGTTCATGTCCATCACGG

Primer_r
: CTCGTTGGCAGAAGTAGTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1082 bp
Genome contig ID	gi89161203f_23469427
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCCGGGCGACAGTTCAAGACTCCATCTC
Flanking genome sequence (181898 - 181947)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAAAAGGCACACAAGAGTCCCTCACACATCTCTCTTGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	23569427	23651323	22	99.7	Internal No-hit

Primer_f	: ACGAGTTCATGTCCATCACGG
Primer_r	: CTCGTTGGCAGAAGTAGTCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1941

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information