HUGE

Gene/Protein Characteristic Table for KIAA0441

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00537
Accession No. :	AB007901
Description :	Zinc finger and BTB domain-containing protein 24.
HUGO Gene Name :	zinc finger and BTB domain containing 24 (ZBTB24)
Clone Name :	hh00601s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0441
Source :	Human adult brain
Note :	We replaced hh00601, former representative clones for KIAA0441 with hh00601s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5597 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3335 bp

Genome contig ID gi89161210r_109790412
PolyA signal sequence
(CATAAA,-21)
+----*----+----*----+----*----+----
CTTATCTAGGTTTTCATAAATGGGAATGTAACAAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCTTCCAAATATGGAGTCCTTACTATTGTCCAGGAGCCAAGCCAGGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 109890412 109911133 7 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09740	100.0	zinc finger and...	synthetic construct
O43167	99.9	Zinc finger and...	Homo sapiens
XP_001153734	99.4	zinc finger and...	Pan troglodytes
XP_001088667	98.1	zinc finger and...	Macaca mulatta
XP_590553	93.7	similar to Zinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023189	9.2e-28	35.7	KIAA0972
AB037852	6.6e-27	41.0	KIAA1431
AB046831	1.2e-26	44.2	KIAA1611
AB075849	2.3e-26	35.2	KIAA1969
AB075836	2.5e-26	44.5	KIAA1956

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 300 322 PD000003 Zinc finger

IPR007087 327 350 PD000003 Zinc finger

IPR007087 439 461 PD000003 Zinc finger

HMMPfam IPR013069 32 138 PF00651 BTB/POZ

IPR000637 164 176 PF02178 HMG-I and HMG-Y

IPR007087 299 321 PF00096 Zinc finger

IPR007087 327 349 PF00096 Zinc finger

IPR007087 355 377 PF00096 Zinc finger

IPR007087 383 405 PF00096 Zinc finger

IPR007087 411 433 PF00096 Zinc finger

IPR007087 439 461 PF00096 Zinc finger

IPR007087 467 489 PF00096 Zinc finger

IPR007087 495 517 PF00096 Zinc finger

HMMSmart IPR000210 42 138 SM00225 BTB/POZ-like

IPR015880 299 321 SM00355 Zinc finger

IPR015880 327 349 SM00355 Zinc finger

IPR015880 355 377 SM00355 Zinc finger

IPR015880 383 405 SM00355 Zinc finger

IPR015880 411 433 SM00355 Zinc finger

IPR015880 439 461 SM00355 Zinc finger

IPR015880 467 489 SM00355 Zinc finger

IPR015880 495 517 SM00355 Zinc finger

ProfileScan IPR000210 42 108 PS50097 BTB/POZ-like

IPR007087 299 326 PS50157 Zinc finger

IPR007087 327 354 PS50157 Zinc finger

IPR007087 355 382 PS50157 Zinc finger

IPR007087 383 410 PS50157 Zinc finger

IPR007087 411 438 PS50157 Zinc finger

IPR007087 439 466 PS50157 Zinc finger

IPR007087 467 494 PS50157 Zinc finger

IPR007087 495 522 PS50157 Zinc finger

ScanRegExp IPR007087 301 321 PS00028 Zinc finger

IPR007087 329 349 PS00028 Zinc finger

IPR007087 357 377 PS00028 Zinc finger

IPR007087 385 405 PS00028 Zinc finger

IPR007087 413 433 PS00028 Zinc finger

IPR007087 441 461 PS00028 Zinc finger

IPR007087 469 489 PS00028 Zinc finger

IPR007087 497 517 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	300	322	PD000003	Zinc finger
IPR007087	327	350	PD000003	Zinc finger
IPR007087	439	461	PD000003	Zinc finger
HMMPfam	IPR013069	32	138	PF00651	BTB/POZ
IPR000637	164	176	PF02178	HMG-I and HMG-Y
IPR007087	299	321	PF00096	Zinc finger
IPR007087	327	349	PF00096	Zinc finger
IPR007087	355	377	PF00096	Zinc finger
IPR007087	383	405	PF00096	Zinc finger
IPR007087	411	433	PF00096	Zinc finger
IPR007087	439	461	PF00096	Zinc finger
IPR007087	467	489	PF00096	Zinc finger
IPR007087	495	517	PF00096	Zinc finger
HMMSmart	IPR000210	42	138	SM00225	BTB/POZ-like
IPR015880	299	321	SM00355	Zinc finger
IPR015880	327	349	SM00355	Zinc finger
IPR015880	355	377	SM00355	Zinc finger
IPR015880	383	405	SM00355	Zinc finger
IPR015880	411	433	SM00355	Zinc finger
IPR015880	439	461	SM00355	Zinc finger
IPR015880	467	489	SM00355	Zinc finger
IPR015880	495	517	SM00355	Zinc finger
ProfileScan	IPR000210	42	108	PS50097	BTB/POZ-like
IPR007087	299	326	PS50157	Zinc finger
IPR007087	327	354	PS50157	Zinc finger
IPR007087	355	382	PS50157	Zinc finger
IPR007087	383	410	PS50157	Zinc finger
IPR007087	411	438	PS50157	Zinc finger
IPR007087	439	466	PS50157	Zinc finger
IPR007087	467	494	PS50157	Zinc finger
IPR007087	495	522	PS50157	Zinc finger
ScanRegExp	IPR007087	301	321	PS00028	Zinc finger
IPR007087	329	349	PS00028	Zinc finger
IPR007087	357	377	PS00028	Zinc finger
IPR007087	385	405	PS00028	Zinc finger
IPR007087	413	433	PS00028	Zinc finger
IPR007087	441	461	PS00028	Zinc finger
IPR007087	469	489	PS00028	Zinc finger
IPR007087	497	517	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTCAAGAAGCACTGGGCAAGC

Primer_r
: TAGAATGTTATGCTTTGGGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCAAGAAGCACTGGGCAAGC
Primer_r	: TAGAATGTTATGCTTTGGGGC
PCR product length	: 152 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3335 bp
Genome contig ID	gi89161210r_109790412
PolyA signal sequence (CATAAA,-21)	+--------+--------+----*----+---- CTTATCTAGGTTTTCATAAATGGGAATGTAACAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTTCCAAATATGGAGTCCTTACTATTGTCCAGGAGCCAAGCCAGGTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	109890412	109911133	7	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0441

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information