HUGE |
Gene/Protein Characteristic Table for KIAA0453 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK07340 |
---|---|
Accession No. : | AB007922 |
Description : | Vacuolar protein sorting-associated protein 13D. |
HUGO Gene Name : | vacuolar protein sorting 13 homolog D (S. cerevisiae) (VPS13D) |
Clone Name : | ff02431 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced hg00489, former representative clones for KIAA0453 with ff02431. (2003/8/28) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 10969 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1337 bp Genome contig ID gi89161185f_12159765 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTAAATTTTTATTTTAATAAAGCTAATCAATTTCTFlanking genome sequence
(333239 - 333288) ----+----*----+----*----+----*----+----*----+----*
ACAACCTTGTCACATGTAGCTGAGTCTGGGATGACTCAGTGGATCAGTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 12259765 12493002 52 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 3209 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CAAGGCATTTTATTCCACAGG | |
: TTTGTAAGTATGATCTGGGCC | |
: 173 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |