HUGE

Gene/Protein Characteristic Table for KIAA0453

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07340
Accession No. :	AB007922
Description :	Vacuolar protein sorting-associated protein 13D.
HUGO Gene Name :	vacuolar protein sorting 13 homolog D (S. cerevisiae) (VPS13D)
Clone Name :	ff02431 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hg00489, former representative clones for KIAA0453 with ff02431. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 10969 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1337 bp

Genome contig ID gi89161185f_12159765
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTAAATTTTTATTTTAATAAAGCTAATCAATTTCT
Flanking genome sequence
(333239 - 333288)
----+----*----+----*----+----*----+----*----+----*
ACAACCTTGTCACATGTAGCTGAGTCTGGGATGACTCAGTGGATCAGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 12259765 12493002 52 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 3209 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5THJ4	100.0	Vacuolar protei...	Homo sapiens
NP_056193	100.0	vacuolar protei...	Homo sapiens
CAE75586	99.9	VPS13D-1A prote...	Homo sapiens
XP_514406	99.6	vacuolar protei...	Pan troglodytes
XP_001490982	95.0	vacuolar protei...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023203	5.1e-10	21.3	KIAA0986
AB037842	2.3e-06	21.9	KIAA1421
AB011104	0.00017	20.9	KIAA0532

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000449 1459 1498 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

IPR009543 2084 2394 PF06650 Vacuolar protein sorting-associated protein

HMMSmart IPR000449 1460 1497 SM00165 Ubiquitin-associated/Translation elongation factor EF1B

ProfileScan IPR000449 1455 1498 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	1459	1498	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
IPR009543	2084	2394	PF06650	Vacuolar protein sorting-associated protein
HMMSmart	IPR000449	1460	1497	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000449	1455	1498	PS50030	Ubiquitin-associated/Translation elongation factor EF1B

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAAGGCATTTTATTCCACAGG
Primer_r	: TTTGTAAGTATGATCTGGGCC
PCR product length	: 173 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1337 bp
Genome contig ID	gi89161185f_12159765
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTAAATTTTTATTTTAATAAAGCTAATCAATTTCT
Flanking genome sequence (333239 - 333288)	----+--------+--------+--------+--------+----* ACAACCTTGTCACATGTAGCTGAGTCTGGGATGACTCAGTGGATCAGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	12259765	12493002	52	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0453

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information