HUGE

Gene/Protein Characteristic Table for KIAA0986

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07338
Accession No. :	AB023203
Description :	Vacuolar protein sorting-associated protein 13A.
HUGO Gene Name :	vacuolar protein sorting 13 homolog A (S. cerevisiae) (VPS13A)
Clone Name :	hj08124 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4779 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 400 bp

Genome contig ID gi89161216f_79022388
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAATTTTCTGGGCTTTAATGTAATGCCACTGTGT
Flanking genome sequence
(167433 - 167482)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGGAAGAAAATAGTAATAGCCATTTAATGTTTTATATTTATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 79122388 79189819 30 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1458 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB59128	100.0	chorein [Homo s...	Homo sapiens
XP_520084	99.4	vacuolar protei...	Pan troglodytes
CAE75581	99.2	chorein 2A [Hom...	Homo sapiens
AAK61861	99.2	chorea-acanthoc...	Homo sapiens
Q96RL7	99.2	Vacuolar protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011104	3.9e-12	28.5	KIAA0532
AB007922	7.9e-11	21.2	KIAA0453

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009543 554 831 PF06650 Vacuolar protein sorting-associated protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009543	554	831	PF06650	Vacuolar protein sorting-associated protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCCATGAATAAGCAACCAGC

Primer_r
: GTCTATGATGCCTCCAGTTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	400 bp
Genome contig ID	gi89161216f_79022388
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAATTTTCTGGGCTTTAATGTAATGCCACTGTGT
Flanking genome sequence (167433 - 167482)	----+--------+--------+--------+--------+----* AAAAAAAAAGGAAGAAAATAGTAATAGCCATTTAATGTTTTATATTTATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	79122388	79189819	30	99.9	Perfect prediction

Primer_f	: AGCCATGAATAAGCAACCAGC
Primer_r	: GTCTATGATGCCTCCAGTTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0986

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information