HUGE

Gene/Protein Characteristic Table for KIAA0532

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00554
Accession No. :	AB011104
Description :	Vacuolar protein sorting-associated protein 13B.
HUGO Gene Name :
Clone Name :	hg03377 [Vector Info]
Flexi ORF Clone :	pF1KSDA0532
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6827 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1913 bp

Genome contig ID gi51511724f_100748208
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACAGGTTTTGTTATAATAAAGTTACTGATTAAATT
Flanking genome sequence
(210777 - 210826)
----+----*----+----*----+----*----+----*----+----*
AGCTTTGAATAAGTGTCATTTTTTAAAGTTCTCCAGTATCACTTTGCTCG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 100848208 100958983 23 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1637 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAE75585	100.0	VPS13B-2A prote...	Homo sapiens
AAP41103	100.0	Cohen syndrome ...	Homo sapiens
CAE75584	100.0	VPS13B-1A prote...	Homo sapiens
Q7Z7G8	100.0	Vacuolar protei...	Homo sapiens
EAW91787	99.9	vacuolar protei...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023203	4.3e-13	28.8	KIAA0986
AB007922	1.9e-05	21.7	KIAA0453

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR006025 904 913 PS00142 Peptidase M

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR006025	904	913	PS00142	Peptidase M

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCTATGGGTGGTCAGTAATTC

Primer_r
: CAACCTCAGAGTAACTATTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCTATGGGTGGTCAGTAATTC
Primer_r	: CAACCTCAGAGTAACTATTTC
PCR product length	: 138 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1913 bp
Genome contig ID	gi51511724f_100748208
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACAGGTTTTGTTATAATAAAGTTACTGATTAAATT
Flanking genome sequence (210777 - 210826)	----+--------+--------+--------+--------+----* AGCTTTGAATAAGTGTCATTTTTTAAAGTTCTCCAGTATCACTTTGCTCG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	100848208	100958983	23	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0532

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information