HUGE |
Gene/Protein Characteristic Table for KIAA0476 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00087 |
---|---|
Accession No. : | AB007945 |
Description : | DENN/MADD domain containing 4B. |
HUGO Gene Name : | |
Clone Name : | ah04654 [Vector Info] |
Flexi ORF Clone : | pF1KA0476
![]() |
Source : | Human brain (amygdala) |
Note : | We replaced hh00487, former representative clones for KIAA0476 with ah04654. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5688 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 796 bp Genome contig ID gi89161185r_152068601 PolyA signal sequence
(AGTAAA,-25) +----*----+----*----+----*----+----
ATGTAAATATAGTAAAAGCTGCTTCTGTCTTTTTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
CTTCGGCCTCCTGTTCCCTGGGTCTGGGGTAATGCGGGGATACCTTTCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 152168601 152185778 28 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1626 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CTCCATAAGAACCTCATAAGC | |
: AATAATGGTCCCTCTTCCCTG | |
: 135 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |