HUGE

Gene/Protein Characteristic Table for KIAA1766

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB051553
Description :	Myotubularin-related protein 13.
HUGO Gene Name :	SET binding factor 2 (SBF2)
Clone Name :	fj16085 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4772 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1435 bp

Genome contig ID gi51511727r_9716182
PolyA signal sequence
(AAGAAA,-24)
+----*----+----*----+----*----+----
GTTCCAATTCAAAGAAAGAGATCAGGGTTTGCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGTGGCTGGGCTCAGTGGCTCACGCCTGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 9816182 10172080 25 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1123 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q86WG5	100.0	Myotubularin-re...	Homo sapiens
AAI01467	100.0	SET binding fac...	Homo sapiens
EAW68574	99.8	hCG1811037, iso...	Homo sapiens
EAW68575	99.8	hCG1811037, iso...	Homo sapiens
EAW68579	99.8	hCG2043060 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007945	8.7e-20	28.0	KIAA0476
AB029014	5e-13	27.4	KIAA1091
AB033103	1.7e-09	25.4	KIAA1277
AB002356	1.7e-08	25.1	KIAA0358
AB020677	1.7e-08	24.9	KIAA0870

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005113 1 57 PF03456 uDENN

IPR001194 87 269 PF02141 DENN

IPR005112 322 391 PF03455 dDENN

IPR004182 842 928 PF02893 GRAM

HMMSmart IPR005113 1 57 SM00800 uDENN

IPR001194 87 269 SM00799 DENN

IPR005112 322 391 SM00801 dDENN

IPR004182 842 928 SM00568 GRAM

ProfileScan IPR005113 1 63 PS50946 uDENN

IPR001194 87 269 PS50211 DENN

IPR005112 322 391 PS50947 dDENN

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005113	1	57	PF03456	uDENN
IPR001194	87	269	PF02141	DENN
IPR005112	322	391	PF03455	dDENN
IPR004182	842	928	PF02893	GRAM
HMMSmart	IPR005113	1	57	SM00800	uDENN
IPR001194	87	269	SM00799	DENN
IPR005112	322	391	SM00801	dDENN
IPR004182	842	928	SM00568	GRAM
ProfileScan	IPR005113	1	63	PS50946	uDENN
IPR001194	87	269	PS50211	DENN
IPR005112	322	391	PS50947	dDENN

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACGAACAGCTTTATCCCAC

Primer_r
: ATCATTCTCGACCAAACCACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: CCR
Primer_f	: CCACGAACAGCTTTATCCCAC
Primer_r	: ATCATTCTCGACCAAACCACG
PCR product length	: 186(1.4k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1435 bp
Genome contig ID	gi51511727r_9716182
PolyA signal sequence (AAGAAA,-24)	+--------+--------+----*----+---- GTTCCAATTCAAAGAAAGAGATCAGGGTTTGCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGTGGCTGGGCTCAGTGGCTCACGCCTGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	9816182	10172080	25	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1766

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information