| HUGE |
Gene/Protein Characteristic Table for KIAA1277 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | |
| Product ID : | ORK00794 |
|---|---|
| Accession No. : | AB033103 |
| Description : | DENN domain-containing protein 2A. |
| HUGO Gene Name : | |
| Clone Name : | fj11251 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1277
|
| Source : | Human fetal brain |
| Note : | We replaced fh01940, former representative clones for KIAA1277 with fj11251. (1999/11/11) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3737 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 289 bp Genome contig ID gi89161213r_139764728 PolyA signal sequence
(ATTAAA,-19)
TTTTTTTATCTTAGATATTAAAAGTAAGAAAAATGFlanking genome sequence
(99961 - 99912)
TGTGGGTTTTCTGTTTATTATGCCAAGGCCAAGAGGAGCCTGTCCTGCCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 139864689 139987045 19 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1039 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
