HUGE

Gene/Protein Characteristic Table for KIAA1608

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04745
Accession No. :	AB046828
Description :	DENN domain-containing protein 1A.
HUGO Gene Name :
Clone Name :	fj20142 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj11345, former representative clones for KIAA1608 with fj20142. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4797 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1775 bp

Genome contig ID gi89161216r_125081758
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTTTGTGTGCATTCAATAAAATCATCTTGGGGAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GAGGCTGGCATCCCCGTGTCCTTGAAGCTTTTGGGTCGGGGAGGCCCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 125181758 125600615 18 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 872 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH13155	2.2e-194	91.3	unnamed protein...	Homo sapiens
EAW87572	2.3e-194	91.0	DENN/MADD domai...	Homo sapiens
BAH12164	2.6e-194	91.5	unnamed protein...	Homo sapiens
EAW87574	2.7e-194	91.5	DENN/MADD domai...	Homo sapiens
XP_231184	1.7e-151	76.8	similar to CG18...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033103	0.00046	31.6	KIAA1277

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001194 6 171 PF02141 DENN

IPR005112 202 230 PF03455 dDENN

HMMSmart IPR001194 3 171 SM00799 DENN

ProfileScan IPR001194 1 171 PS50211 DENN

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001194	6	171	PF02141	DENN
IPR005112	202	230	PF03455	dDENN
HMMSmart	IPR001194	3	171	SM00799	DENN
ProfileScan	IPR001194	1	171	PS50211	DENN

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TACTCCCCTCACTGTCAAAGC

Primer_r
: AGTTTGTCCTTTCTACCTGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: CCR
Primer_f	: TACTCCCCTCACTGTCAAAGC
Primer_r	: AGTTTGTCCTTTCTACCTGGC
PCR product length	: 205 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1775 bp
Genome contig ID	gi89161216r_125081758
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTTTGTGTGCATTCAATAAAATCATCTTGGGGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAGGCTGGCATCCCCGTGTCCTTGAAGCTTTTGGGTCGGGGAGGCCCCAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	125181758	125600615	18	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1608

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information