HUGE

Gene/Protein Characteristic Table for KIAA0870

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB020677
Description :	DENN/MADD domain containing 3.
HUGO Gene Name :	DENN/MADD domain containing 3 (DENND3)
Clone Name :	hk06970 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4484 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 1566 bp

Genome contig ID gi51511724f_142130155
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TATCTTCAGCTTGTGGAGAATAAATCTGGTTTAAT
Flanking genome sequence
(144927 - 144976)
----+----*----+----*----+----*----+----*----+----*
AAACACTGATGTCCGGCTCCTTACTTCATCCAACAGTGACGGGGGGAAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 142230155 142275080 18 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1019 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A2RUS2	100.0	DENN domain-con...	Homo sapiens
EAW92217	100.0	DENN/MADD domai...	Homo sapiens
XP_519983	97.4	hypothetical pr...	Pan troglodytes
XP_001082457	91.8	similar to DENN...	Macaca mulatta
XP_001499398	82.2	similar to DENN...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029014	4e-09	30.1	KIAA1091
AB051553	3.3e-08	24.9	KIAA1766
AB002356	8.7e-08	27.1	KIAA0358
AB046828	1.3e-07	30.6	KIAA1608
AB033103	3.7e-07	25.5	KIAA1277

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001194 1 112 PF02141 DENN

IPR005112 175 238 PF03455 dDENN

IPR001680 797 838 PF00400 WD40 repeat

HMMSmart IPR001194 1 112 SM00799 DENN

IPR005112 175 238 SM00801 dDENN

IPR001680 753 793 SM00320 WD40 repeat

IPR001680 796 838 SM00320 WD40 repeat

IPR001680 977 1017 SM00320 WD40 repeat

ProfileScan IPR001194 1 112 PS50211 DENN

IPR005112 175 238 PS50947 dDENN

IPR001680 762 847 PS50294 WD40 repeat

ScanRegExp IPR001680 825 839 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001194	1	112	PF02141	DENN
IPR005112	175	238	PF03455	dDENN
IPR001680	797	838	PF00400	WD40 repeat
HMMSmart	IPR001194	1	112	SM00799	DENN
IPR005112	175	238	SM00801	dDENN
IPR001680	753	793	SM00320	WD40 repeat
IPR001680	796	838	SM00320	WD40 repeat
IPR001680	977	1017	SM00320	WD40 repeat
ProfileScan	IPR001194	1	112	PS50211	DENN
IPR005112	175	238	PS50947	dDENN
IPR001680	762	847	PS50294	WD40 repeat
ScanRegExp	IPR001680	825	839	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGGGCATTCTGAGAGTGTGG

Primer_r
: AGCAAAATCCAACCTCTCCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGGGGCATTCTGAGAGTGTGG
Primer_r	: AGCAAAATCCAACCTCTCCAG
PCR product length	: 116 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	YES

Length of 3'UTR	1566 bp
Genome contig ID	gi51511724f_142130155
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TATCTTCAGCTTGTGGAGAATAAATCTGGTTTAAT
Flanking genome sequence (144927 - 144976)	----+--------+--------+--------+--------+----* AAACACTGATGTCCGGCTCCTTACTTCATCCAACAGTGACGGGGGGAAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	142230155	142275080	18	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0870

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information