HUGE

Gene/Protein Characteristic Table for KIAA0524

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06729
Accession No. :	AB011096
Description :	Sterile alpha and TIR motif-containing protein 1.
HUGO Gene Name :	sterile alpha and TIR motif containing 1 (SARM1)
Clone Name :	hg01923 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6559 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4761 bp

Genome contig ID gi51511734f_23623556
PolyA signal sequence
(CATAAA,-20)
+----*----+----*----+----*----+----
TGACAGAACCCAGCACATAAAAGAAAAAAAAAAGT
Flanking genome sequence
(128638 - 128687)
----+----*----+----*----+----*----+----*----+----*
ACATGTGATATTGTCTGATGAAAGCTTGATGGAAATGGCTTTTTTCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 23723556 23752192 9 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 598 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH40429	100.0	SARM1 protein [...	Homo sapiens
Q6SZW1	100.0	Sterile alpha a...	Homo sapiens
AAI22861	98.6	SARM1 protein [...	Homo sapiens
XP_001504177	96.2	sterile alpha a...	Equus caballus
XP_548285	96.3	similar to ster...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033056	8.9e-06	24.6	KIAA1230

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011510 283 350 PF07647 Sterile alpha motif homology 2

IPR011510 353 422 PF07647 Sterile alpha motif homology 2

HMMSmart IPR001660 283 350 SM00454 Sterile alpha motif SAM

IPR001660 353 422 SM00454 Sterile alpha motif SAM

IPR000157 435 576 SM00255 Toll-Interleukin receptor

ProfileScan IPR001660 286 350 PS50105 Sterile alpha motif SAM

IPR001660 360 422 PS50105 Sterile alpha motif SAM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	283	350	PF07647	Sterile alpha motif homology 2
IPR011510	353	422	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	283	350	SM00454	Sterile alpha motif SAM
IPR001660	353	422	SM00454	Sterile alpha motif SAM
IPR000157	435	576	SM00255	Toll-Interleukin receptor
ProfileScan	IPR001660	286	350	PS50105	Sterile alpha motif SAM
IPR001660	360	422	PS50105	Sterile alpha motif SAM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCAGCCATTTGTTTAGTAGCC

Primer_r
: TCACTTAACCTATGTCTCCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCAGCCATTTGTTTAGTAGCC
Primer_r	: TCACTTAACCTATGTCTCCCC
PCR product length	: 125 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4761 bp
Genome contig ID	gi51511734f_23623556
PolyA signal sequence (CATAAA,-20)	+--------+--------+----*----+---- TGACAGAACCCAGCACATAAAAGAAAAAAAAAAGT
Flanking genome sequence (128638 - 128687)	----+--------+--------+--------+--------+----* ACATGTGATATTGTCTGATGAAAGCTTGATGGAAATGGCTTTTTTCTGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	23723556	23752192	9	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0524

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information