HUGE |
Gene/Protein Characteristic Table for KIAA0593 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05955 |
---|---|
Accession No. : | AB011165 |
Description : | Thyroid hormone receptor-associated protein complex 240 kDa component. |
HUGO Gene Name : | mediator complex subunit 13 (MED13) |
Clone Name : | hj02824s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hj02824, former representative clones for KIAA0593 with hj02824s1. (2003/8/28) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8099 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2079 bp Genome contig ID gi51511734r_57276532 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CATTATGTTGGTATGTTTTGTTCTGTACTTTCTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAACTTGTCTGAGATTTGAAGGAAAATGTGCTTATTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 57376532 57467716 27 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2005 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ACAGCTCAGATTAAGGTAGGG | |
: AGTCAGCAATGCAGGTAGGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: CCR | |
: ACAGCTCAGATTAAGGTAGGG | |
: AGTCAGCAATGCAGGTAGGAG | |
: 229 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |