HUGE

Gene/Protein Characteristic Table for KIAA0593

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05955
Accession No. :	AB011165
Description :	Thyroid hormone receptor-associated protein complex 240 kDa component.
HUGO Gene Name :	mediator complex subunit 13 (MED13)
Clone Name :	hj02824s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hj02824, former representative clones for KIAA0593 with hj02824s1. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 8099 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2079 bp

Genome contig ID gi51511734r_57276532
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CATTATGTTGGTATGTTTTGTTCTGTACTTTCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAACTTGTCTGAGATTTGAAGGAAAATGTGCTTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 57376532 57467716 27 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 2005 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UHV7	100.0	Mediator of RNA...	Homo sapiens
EAW51438	100.0	thyroid hormone...	Homo sapiens
XP_001138050	99.7	mediator of RNA...	Pan troglodytes
AAD22032	99.7	thyroid hormone...	Homo sapiens
XP_001110128	98.9	mediator of RNA...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028948	1.3e-131	51.9	KIAA1025

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009401 1096 1700 PF06333 TRAP240

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009401	1096	1700	PF06333	TRAP240

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACAGCTCAGATTAAGGTAGGG

Primer_r
: AGTCAGCAATGCAGGTAGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: CCR
Primer_f	: ACAGCTCAGATTAAGGTAGGG
Primer_r	: AGTCAGCAATGCAGGTAGGAG
PCR product length	: 229 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2079 bp
Genome contig ID	gi51511734r_57276532
PolyA signal sequence (None)	+--------+--------+----*----+---- CATTATGTTGGTATGTTTTGTTCTGTACTTTCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAACTTGTCTGAGATTTGAAGGAAAATGTGCTTATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	57376532	57467716	27	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0593

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information