HUGE

Gene/Protein Characteristic Table for KIAA1025

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05956
Accession No. :	AB028948
Description :	Thyroid hormone receptor-associated protein 2.
HUGO Gene Name :	mediator complex subunit 13-like (MED13L)
Clone Name :	fg00971s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fg00971, former representative clones for KIAA1025 with fg00971s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8444 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2689 bp

Genome contig ID gi89161190r_114780766
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACACTTTTTTAGAGGAATAAATTATTGAATTACTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGCTTTGAGTGGCTTTTTTCCCTTCCTCTCCTGCCTTTGTATAAAATTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 114880766 114941528 25 99.6 Terminal No-hit

Features of the protein sequence	Description

Length: 1917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW98081	99.8	thyroid hormone...	Homo sapiens
Q71F56	99.8	Mediator of RNA...	Homo sapiens
CAH18186	99.7	hypothetical pr...	Homo sapiens
CAB61363	100.0	hypothetical pr...	Homo sapiens
XP_001112106	98.9	similar to thyr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011165	7.9e-125	51.9	KIAA0593

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009401 1015 1612 PF06333 TRAP240

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009401	1015	1612	PF06333	TRAP240

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTACACTCTGCAAATAACCC

Primer_r
: AAGTTTCCAGGTCCATGAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2689 bp
Genome contig ID	gi89161190r_114780766
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACACTTTTTTAGAGGAATAAATTATTGAATTACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGCTTTGAGTGGCTTTTTTCCCTTCCTCTCCTGCCTTTGTATAAAATTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	114880766	114941528	25	99.6	Terminal No-hit

Primer_f	: GCTACACTCTGCAAATAACCC
Primer_r	: AAGTTTCCAGGTCCATGAGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1025

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information