HUGE

Gene/Protein Characteristic Table for KIAA0656

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01988
Accession No. :	AB014556
Description :	Clathrin coat assembly protein AP180.
HUGO Gene Name :	synaptosomal-associated protein, 91kDa homolog (mouse) (SNAP91)
Clone Name :	hk01789 [Vector Info]
Flexi ORF Clone :	pF1KA0656
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4369 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1402 bp

Genome contig ID gi89161210r_84219332
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CGCCCTCTGAGATGCAATAAACACCTTGAACAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGCAAACATAACGTTTCTCTCTTTGATTATGTTTGGGAAAAAGGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 84319332 84475495 28 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 912 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60641	100.0	Clathrin coat a...	Homo sapiens
XP_001085480	99.6	synaptosomal-as...	Macaca mulatta
EAW48656	99.7	synaptosomal-as...	Homo sapiens
CAH92807	98.9	hypothetical pr...	Pongo abelii
CAB89292	99.1	synaptosomal-as...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	0.0009	24.6	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011417 24 290 PF07651 ANTH

HMMSmart IPR013809 25 150 SM00273 Epsin-like

ProfileScan IPR013809 19 150 PS50942 Epsin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011417	24	290	PF07651	ANTH
HMMSmart	IPR013809	25	150	SM00273	Epsin-like
ProfileScan	IPR013809	19	150	PS50942	Epsin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTTCCATCCTTCAACTGAGC

Primer_r
: CAGCACAGACAGTATGACAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCTTCCATCCTTCAACTGAGC
Primer_r	: CAGCACAGACAGTATGACAAC
PCR product length	: 140 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1402 bp
Genome contig ID	gi89161210r_84219332
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CGCCCTCTGAGATGCAATAAACACCTTGAACAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGCAAACATAACGTTTCTCTCTTTGATTATGTTTGGGAAAAAGGTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	84319332	84475495	28	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0656

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information