HUGE

Gene/Protein Characteristic Table for KIAA0710

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB014610
Description :	PAB-dependent poly(A)-specific ribonuclease subunit 2.
HUGO Gene Name :	PAN2 polyA specific ribonuclease subunit homolog (S. cerevisiae) (PAN2)
Clone Name :	hj00237 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4910 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 672 bp

Genome contig ID gi89161190r_54896988
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
AAAATAAAAATAAAATATCGTTTGTTATTTATCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTAGAGAACTGCTAGTGTGGGTTCTCTGGCTTCAGTCTTCCTCTCCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 54996988 55014001 26 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1206 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW96932	100.0	ubiquitin speci...	Homo sapiens
Q504Q3	99.9	PAB-dependent p...	Homo sapiens
AAH94885	99.8	PAN2 protein [H...	Homo sapiens
BAD02263	99.6	PABP1-DEPENDENT...	Homo sapiens
XP_001114958	99.3	similar to ubiq...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013520 978 1151 PF00929 Exonuclease

HMMSmart IPR006055 977 1160 SM00479 Exonuclease

ProfileScan IPR001394 522 929 PS50235 Peptidase C19

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013520	978	1151	PF00929	Exonuclease
HMMSmart	IPR006055	977	1160	SM00479	Exonuclease
ProfileScan	IPR001394	522	929	PS50235	Peptidase C19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACAGTGGTACAGACATGGAG

Primer_r
: AGTTATGGTTCCAGGAGCTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACAGTGGTACAGACATGGAG
Primer_r	: AGTTATGGTTCCAGGAGCTTC
PCR product length	: 110 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	672 bp
Genome contig ID	gi89161190r_54896988
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AAAATAAAAATAAAATATCGTTTGTTATTTATCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTAGAGAACTGCTAGTGTGGGTTCTCTGGCTTCAGTCTTCCTCTCCTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	54996988	55014001	26	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0710

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information