HUGE

Gene/Protein Characteristic Table for KIAA0759

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00626
Accession No. :	AB018302
Description :	Protein angel homolog 1.
HUGO Gene Name :	angel homolog 2 (Drosophila) (ANGEL2)
Clone Name :	hk04621 [Vector Info]
Flexi ORF Clone :	pF1KSDA0759
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4006 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1983 bp

Genome contig ID gi51511730r_76223341
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CTTTTTCCAAATAAAGGTTTACCTTTTTTCCCCCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGTTGTTCATTTTATTAGGATCCTGAAGGGATTAGGTCCTTGAGAGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 76323341 76348933 10 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 673 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH28714	99.9	Angel homolog 1...	Homo sapiens
XP_001163194	99.4	angel homolog 1...	Pan troglodytes
EAW81261	99.3	angel homolog 1...	Homo sapiens
XP_510084	99.4	angel homolog 1...	Pan troglodytes
XP_001163086	99.4	angel homolog 1...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033020	0.00059	31.6	KIAA1194

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005135 248 666 PF03372 Endonuclease/exonuclease/phosphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005135	248	666	PF03372	Endonuclease/exonuclease/phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACCATTCATTCTGTCTGTC

Primer_r
: CTATCAAGCATCTGCCCTCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCACCATTCATTCTGTCTGTC
Primer_r	: CTATCAAGCATCTGCCCTCTG
PCR product length	: 159 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1983 bp
Genome contig ID	gi51511730r_76223341
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CTTTTTCCAAATAAAGGTTTACCTTTTTTCCCCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTTGTTCATTTTATTAGGATCCTGAAGGGATTAGGTCCTTGAGAGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	76323341	76348933	10	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0759

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information