HUGE

Gene/Protein Characteristic Table for KIAA1194

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00760
Accession No. :	AB033020
Description :	CCR4-NOT transcription complex subunit 6.
HUGO Gene Name :	CCR4-NOT transcription complex, subunit 6 (CNOT6)
Clone Name :	fg00908 [Vector Info]
Flexi ORF Clone :	pF1KSDA1194
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6255 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4157 bp

Genome contig ID gi51511721f_179754180
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AGGTTGACATATTTTAAATAAATGCTTTTAAATAC
Flanking genome sequence
(183777 - 183826)
----+----*----+----*----+----*----+----*----+----*
AGTAGCAAACATTGTGTTGGGGTTATAATAATTCATTAAATGTCTTGTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 179854039 179937955 14 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 575 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULM6	100.0	CCR4-NOT transc...	Homo sapiens
XP_538584	98.0	similar to CCR4...	Canis lupus fam...
XP_001500898	97.8	CCR4-NOT transc...	Equus caballus
AAI50117	97.5	CNOT6 protein [...	Bos taurus
XP_001381153	95.9	similar to CCR4...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037858	7.4e-08	38.1	KIAA1437
D63481	1.5e-07	40.8	KIAA0147
AB023148	3.3e-07	31.0	KIAA0931
AB020669	4.6e-07	32.8	KIAA0862
AB051461	1.1e-06	31.6	KIAA1674

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 71 84 PR00019 Leucine-rich repeat

IPR001611 91 104 PR00019 Leucine-rich repeat

HMMPfam IPR001611 70 91 PF00560 Leucine-rich repeat

IPR001611 93 114 PF00560 Leucine-rich repeat

IPR001611 116 137 PF00560 Leucine-rich repeat

IPR005135 207 556 PF03372 Endonuclease/exonuclease/phosphatase

HMMSmart IPR003591 68 90 SM00369 Leucine-rich repeat

IPR003591 91 113 SM00369 Leucine-rich repeat

IPR003591 114 137 SM00369 Leucine-rich repeat

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	71	84	PR00019	Leucine-rich repeat
IPR001611	91	104	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	70	91	PF00560	Leucine-rich repeat
IPR001611	93	114	PF00560	Leucine-rich repeat
IPR001611	116	137	PF00560	Leucine-rich repeat
IPR005135	207	556	PF03372	Endonuclease/exonuclease/phosphatase
HMMSmart	IPR003591	68	90	SM00369	Leucine-rich repeat
IPR003591	91	113	SM00369	Leucine-rich repeat
IPR003591	114	137	SM00369	Leucine-rich repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTGTGTTGGTAATGTGCATC

Primer_r
: ATAAAGCTCTCTGGACCTGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4157 bp
Genome contig ID	gi51511721f_179754180
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGGTTGACATATTTTAAATAAATGCTTTTAAATAC
Flanking genome sequence (183777 - 183826)	----+--------+--------+--------+--------+----* AGTAGCAAACATTGTGTTGGGGTTATAATAATTCATTAAATGTCTTGTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	179854039	179937955	14	99.3	Perfect prediction

Primer_f	: ACTGTGTTGGTAATGTGCATC
Primer_r	: ATAAAGCTCTCTGGACCTGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1194

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information