HUGE

Gene/Protein Characteristic Table for KIAA0760

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00627
Accession No. :	AB018303
Description :	zinc finger protein 423.
HUGO Gene Name :	zinc finger protein 423 (ZNF423)
Clone Name :	hk04642s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0760
Source :	Human adult brain
Note :	We replaced hk04642, former representative clones for KIAA0760 with hk04642s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 573 bp

Genome contig ID gi51511732r_47982115
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
TCACCGGACAGTGATTAAAACTATGTAATGAATAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATCGGTTTCAGTGCAACTGGATGGTCTGCTTTTAAATGTGACTTAATCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 48082115 48322279 6 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 1224 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q2M1K9	100.0	Zinc finger pro...	Homo sapiens
XP_520629	99.9	zinc finger pro...	Pan troglodytes
XP_001163978	99.9	zinc finger pro...	Pan troglodytes
AAI48947	98.9	ZNF423 protein ...	Bos taurus
XP_001476381	98.4	similar to earl...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075834	8.9e-15	27.0	KIAA1954
AB107355	2e-12	26.5	KIAA2033
AB058730	5.9e-12	25.0	KIAA1827
AB033024	2.3e-11	25.9	KIAA1198
AB023189	2.4e-11	29.3	KIAA0972

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 134 157 PD000003 Zinc finger

HMMPfam IPR007087 78 100 PF00096 Zinc finger

IPR007087 106 128 PF00096 Zinc finger

IPR007087 134 156 PF00096 Zinc finger

IPR007087 162 184 PF00096 Zinc finger

IPR007087 203 226 PF00096 Zinc finger

IPR007087 349 373 PF00096 Zinc finger

IPR007087 381 404 PF00096 Zinc finger

IPR007087 420 443 PF00096 Zinc finger

IPR007087 572 594 PF00096 Zinc finger

IPR007087 602 624 PF00096 Zinc finger

IPR007087 632 655 PF00096 Zinc finger

IPR007087 660 683 PF00096 Zinc finger

IPR007087 690 713 PF00096 Zinc finger

IPR007087 721 743 PF00096 Zinc finger

IPR007087 826 849 PF00096 Zinc finger

IPR007087 870 892 PF00096 Zinc finger

IPR007087 899 921 PF00096 Zinc finger

IPR007087 1060 1083 PF00096 Zinc finger

IPR007087 1138 1160 PF00096 Zinc finger

IPR007087 1169 1192 PF00096 Zinc finger

IPR007087 1199 1222 PF00096 Zinc finger

HMMSmart IPR015880 7 28 SM00355 Zinc finger

IPR015880 78 100 SM00355 Zinc finger

IPR015880 106 128 SM00355 Zinc finger

IPR015880 134 156 SM00355 Zinc finger

IPR015880 162 184 SM00355 Zinc finger

IPR015880 203 226 SM00355 Zinc finger

IPR015880 235 258 SM00355 Zinc finger

IPR015880 263 285 SM00355 Zinc finger

IPR015880 349 373 SM00355 Zinc finger

IPR015880 381 404 SM00355 Zinc finger

IPR015880 420 443 SM00355 Zinc finger

IPR015880 457 480 SM00355 Zinc finger

IPR015880 503 528 SM00355 Zinc finger

IPR015880 572 594 SM00355 Zinc finger

IPR015880 602 624 SM00355 Zinc finger

IPR015880 632 655 SM00355 Zinc finger

IPR015880 660 683 SM00355 Zinc finger

IPR015880 690 713 SM00355 Zinc finger

IPR015880 721 743 SM00355 Zinc finger

IPR015880 747 770 SM00355 Zinc finger

IPR015880 826 849 SM00355 Zinc finger

IPR015880 870 892 SM00355 Zinc finger

IPR015880 899 921 SM00355 Zinc finger

IPR015880 928 950 SM00355 Zinc finger

IPR015880 960 982 SM00355 Zinc finger

IPR015880 1060 1083 SM00355 Zinc finger

IPR015880 1108 1130 SM00355 Zinc finger

IPR015880 1138 1160 SM00355 Zinc finger

IPR015880 1169 1192 SM00355 Zinc finger

IPR015880 1199 1222 SM00355 Zinc finger

ProfileScan IPR007087 78 105 PS50157 Zinc finger

IPR007087 106 133 PS50157 Zinc finger

IPR007087 134 161 PS50157 Zinc finger

IPR007087 162 189 PS50157 Zinc finger

IPR007087 203 231 PS50157 Zinc finger

IPR007087 235 263 PS50157 Zinc finger

IPR007087 420 448 PS50157 Zinc finger

IPR007087 457 480 PS50157 Zinc finger

IPR007087 572 594 PS50157 Zinc finger

IPR007087 602 624 PS50157 Zinc finger

IPR007087 632 656 PS50157 Zinc finger

IPR007087 660 688 PS50157 Zinc finger

IPR007087 690 718 PS50157 Zinc finger

IPR007087 721 748 PS50157 Zinc finger

IPR007087 747 770 PS50157 Zinc finger

IPR007087 826 853 PS50157 Zinc finger

IPR007087 870 897 PS50157 Zinc finger

IPR007087 899 926 PS50157 Zinc finger

IPR007087 1060 1088 PS50157 Zinc finger

IPR007087 1108 1135 PS50157 Zinc finger

IPR007087 1138 1165 PS50157 Zinc finger

IPR007087 1169 1197 PS50157 Zinc finger

IPR007087 1199 1224 PS50157 Zinc finger

ScanRegExp IPR007087 80 100 PS00028 Zinc finger

IPR007087 108 128 PS00028 Zinc finger

IPR007087 136 156 PS00028 Zinc finger

IPR007087 164 184 PS00028 Zinc finger

IPR007087 205 226 PS00028 Zinc finger

IPR007087 237 258 PS00028 Zinc finger

IPR007087 265 285 PS00028 Zinc finger

IPR007087 383 404 PS00028 Zinc finger

IPR007087 422 443 PS00028 Zinc finger

IPR007087 459 480 PS00028 Zinc finger

IPR007087 574 594 PS00028 Zinc finger

IPR007087 604 624 PS00028 Zinc finger

IPR007087 634 655 PS00028 Zinc finger

IPR007087 662 683 PS00028 Zinc finger

IPR007087 692 713 PS00028 Zinc finger

IPR007087 723 743 PS00028 Zinc finger

IPR007087 749 770 PS00028 Zinc finger

IPR007087 828 849 PS00028 Zinc finger

IPR007087 872 892 PS00028 Zinc finger

IPR007087 901 921 PS00028 Zinc finger

IPR007087 930 950 PS00028 Zinc finger

IPR007087 962 982 PS00028 Zinc finger

IPR007087 1062 1083 PS00028 Zinc finger

IPR007087 1110 1130 PS00028 Zinc finger

IPR007087 1140 1160 PS00028 Zinc finger

IPR007087 1171 1192 PS00028 Zinc finger

IPR007087 1201 1222 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	134	157	PD000003	Zinc finger
HMMPfam	IPR007087	78	100	PF00096	Zinc finger
IPR007087	106	128	PF00096	Zinc finger
IPR007087	134	156	PF00096	Zinc finger
IPR007087	162	184	PF00096	Zinc finger
IPR007087	203	226	PF00096	Zinc finger
IPR007087	349	373	PF00096	Zinc finger
IPR007087	381	404	PF00096	Zinc finger
IPR007087	420	443	PF00096	Zinc finger
IPR007087	572	594	PF00096	Zinc finger
IPR007087	602	624	PF00096	Zinc finger
IPR007087	632	655	PF00096	Zinc finger
IPR007087	660	683	PF00096	Zinc finger
IPR007087	690	713	PF00096	Zinc finger
IPR007087	721	743	PF00096	Zinc finger
IPR007087	826	849	PF00096	Zinc finger
IPR007087	870	892	PF00096	Zinc finger
IPR007087	899	921	PF00096	Zinc finger
IPR007087	1060	1083	PF00096	Zinc finger
IPR007087	1138	1160	PF00096	Zinc finger
IPR007087	1169	1192	PF00096	Zinc finger
IPR007087	1199	1222	PF00096	Zinc finger
HMMSmart	IPR015880	7	28	SM00355	Zinc finger
IPR015880	78	100	SM00355	Zinc finger
IPR015880	106	128	SM00355	Zinc finger
IPR015880	134	156	SM00355	Zinc finger
IPR015880	162	184	SM00355	Zinc finger
IPR015880	203	226	SM00355	Zinc finger
IPR015880	235	258	SM00355	Zinc finger
IPR015880	263	285	SM00355	Zinc finger
IPR015880	349	373	SM00355	Zinc finger
IPR015880	381	404	SM00355	Zinc finger
IPR015880	420	443	SM00355	Zinc finger
IPR015880	457	480	SM00355	Zinc finger
IPR015880	503	528	SM00355	Zinc finger
IPR015880	572	594	SM00355	Zinc finger
IPR015880	602	624	SM00355	Zinc finger
IPR015880	632	655	SM00355	Zinc finger
IPR015880	660	683	SM00355	Zinc finger
IPR015880	690	713	SM00355	Zinc finger
IPR015880	721	743	SM00355	Zinc finger
IPR015880	747	770	SM00355	Zinc finger
IPR015880	826	849	SM00355	Zinc finger
IPR015880	870	892	SM00355	Zinc finger
IPR015880	899	921	SM00355	Zinc finger
IPR015880	928	950	SM00355	Zinc finger
IPR015880	960	982	SM00355	Zinc finger
IPR015880	1060	1083	SM00355	Zinc finger
IPR015880	1108	1130	SM00355	Zinc finger
IPR015880	1138	1160	SM00355	Zinc finger
IPR015880	1169	1192	SM00355	Zinc finger
IPR015880	1199	1222	SM00355	Zinc finger
ProfileScan	IPR007087	78	105	PS50157	Zinc finger
IPR007087	106	133	PS50157	Zinc finger
IPR007087	134	161	PS50157	Zinc finger
IPR007087	162	189	PS50157	Zinc finger
IPR007087	203	231	PS50157	Zinc finger
IPR007087	235	263	PS50157	Zinc finger
IPR007087	420	448	PS50157	Zinc finger
IPR007087	457	480	PS50157	Zinc finger
IPR007087	572	594	PS50157	Zinc finger
IPR007087	602	624	PS50157	Zinc finger
IPR007087	632	656	PS50157	Zinc finger
IPR007087	660	688	PS50157	Zinc finger
IPR007087	690	718	PS50157	Zinc finger
IPR007087	721	748	PS50157	Zinc finger
IPR007087	747	770	PS50157	Zinc finger
IPR007087	826	853	PS50157	Zinc finger
IPR007087	870	897	PS50157	Zinc finger
IPR007087	899	926	PS50157	Zinc finger
IPR007087	1060	1088	PS50157	Zinc finger
IPR007087	1108	1135	PS50157	Zinc finger
IPR007087	1138	1165	PS50157	Zinc finger
IPR007087	1169	1197	PS50157	Zinc finger
IPR007087	1199	1224	PS50157	Zinc finger
ScanRegExp	IPR007087	80	100	PS00028	Zinc finger
IPR007087	108	128	PS00028	Zinc finger
IPR007087	136	156	PS00028	Zinc finger
IPR007087	164	184	PS00028	Zinc finger
IPR007087	205	226	PS00028	Zinc finger
IPR007087	237	258	PS00028	Zinc finger
IPR007087	265	285	PS00028	Zinc finger
IPR007087	383	404	PS00028	Zinc finger
IPR007087	422	443	PS00028	Zinc finger
IPR007087	459	480	PS00028	Zinc finger
IPR007087	574	594	PS00028	Zinc finger
IPR007087	604	624	PS00028	Zinc finger
IPR007087	634	655	PS00028	Zinc finger
IPR007087	662	683	PS00028	Zinc finger
IPR007087	692	713	PS00028	Zinc finger
IPR007087	723	743	PS00028	Zinc finger
IPR007087	749	770	PS00028	Zinc finger
IPR007087	828	849	PS00028	Zinc finger
IPR007087	872	892	PS00028	Zinc finger
IPR007087	901	921	PS00028	Zinc finger
IPR007087	930	950	PS00028	Zinc finger
IPR007087	962	982	PS00028	Zinc finger
IPR007087	1062	1083	PS00028	Zinc finger
IPR007087	1110	1130	PS00028	Zinc finger
IPR007087	1140	1160	PS00028	Zinc finger
IPR007087	1171	1192	PS00028	Zinc finger
IPR007087	1201	1222	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCAACCCAGATGTAAAACTC

Primer_r
: TGTAGTCTGCGGCGGAAAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTAAGAACCCTGAGGCACCT
Primer_r	: TTGTGACTGCCCTTGATAAAC
PCR product length	: 206 bp
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	573 bp
Genome contig ID	gi51511732r_47982115
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- TCACCGGACAGTGATTAAAACTATGTAATGAATAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCGGTTTCAGTGCAACTGGATGGTCTGCTTTTAAATGTGACTTAATCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	48082115	48322279	6	99.1	Perfect prediction

Primer_f	: TGCAACCCAGATGTAAAACTC
Primer_r	: TGTAGTCTGCGGCGGAAAGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0760

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information