HUGE

Gene/Protein Characteristic Table for KIAA1954

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07420
Accession No. :	AB075834
Description :	Zinc finger protein 90 homolog.
HUGO Gene Name :	zinc finger protein 90 homolog (mouse) (ZFP90)
Clone Name :	fk02322 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3846 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2439 bp

Genome contig ID gi51511732f_67054696
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CATTGTATTCTTTCAATAAATAGCCTTCTGAGTTG
Flanking genome sequence
(103839 - 103888)
----+----*----+----*----+----*----+----*----+----*
AATGGGAGTCAGTTTGTCGTTTTCAATTTTCAGAACTTGGCTAAGATTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 67154696 67158533 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 468 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW83235	2.7e-205	100.0	zinc finger pro...	Homo sapiens
Q8TF47	2.9e-205	100.0	Zinc finger pro...	Homo sapiens
XP_511056	3.2e-204	99.4	zinc finger pro...	Pan troglodytes
XP_001092619	3.5e-202	98.1	similar to Zinc...	Macaca mulatta
XP_001496976	5.4e-198	95.7	similar to zinc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058774	1.7e-59	44.4	KIAA1871
AB032967	1.7e-46	43.8	KIAA1141
AB007886	1.2e-44	44.9	KIAA0426
AB075836	3e-42	42.8	KIAA1956
AB075842	2.1e-39	42.6	KIAA1962

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 86 109 PD000003 Zinc finger

IPR007087 114 137 PD000003 Zinc finger

IPR007087 142 165 PD000003 Zinc finger

IPR007087 198 221 PD000003 Zinc finger

IPR007087 282 305 PD000003 Zinc finger

IPR007087 329 352 PD000003 Zinc finger

IPR007087 357 380 PD000003 Zinc finger

IPR007087 385 408 PD000003 Zinc finger

IPR007087 413 436 PD000003 Zinc finger

IPR007087 441 463 PD000003 Zinc finger

HMMPfam IPR007087 43 65 PF00096 Zinc finger

IPR007087 86 108 PF00096 Zinc finger

IPR007087 114 136 PF00096 Zinc finger

IPR007087 142 164 PF00096 Zinc finger

IPR007087 170 192 PF00096 Zinc finger

IPR007087 198 220 PF00096 Zinc finger

IPR007087 226 248 PF00096 Zinc finger

IPR007087 282 304 PF00096 Zinc finger

IPR007087 329 351 PF00096 Zinc finger

IPR007087 357 379 PF00096 Zinc finger

IPR007087 385 407 PF00096 Zinc finger

IPR007087 413 435 PF00096 Zinc finger

IPR007087 441 463 PF00096 Zinc finger

HMMSmart IPR015880 43 65 SM00355 Zinc finger

IPR015880 86 108 SM00355 Zinc finger

IPR015880 114 136 SM00355 Zinc finger

IPR015880 142 164 SM00355 Zinc finger

IPR015880 170 192 SM00355 Zinc finger

IPR015880 198 220 SM00355 Zinc finger

IPR015880 226 248 SM00355 Zinc finger

IPR015880 282 304 SM00355 Zinc finger

IPR015880 329 351 SM00355 Zinc finger

IPR015880 357 379 SM00355 Zinc finger

IPR015880 385 407 SM00355 Zinc finger

IPR015880 413 435 SM00355 Zinc finger

IPR015880 441 463 SM00355 Zinc finger

ProfileScan IPR007087 43 70 PS50157 Zinc finger

IPR007087 86 113 PS50157 Zinc finger

IPR007087 114 141 PS50157 Zinc finger

IPR007087 142 169 PS50157 Zinc finger

IPR007087 170 197 PS50157 Zinc finger

IPR007087 198 225 PS50157 Zinc finger

IPR007087 226 253 PS50157 Zinc finger

IPR007087 282 309 PS50157 Zinc finger

IPR007087 329 356 PS50157 Zinc finger

IPR007087 357 384 PS50157 Zinc finger

IPR007087 385 412 PS50157 Zinc finger

IPR007087 413 440 PS50157 Zinc finger

IPR007087 441 468 PS50157 Zinc finger

ScanRegExp IPR007087 45 65 PS00028 Zinc finger

IPR007087 88 108 PS00028 Zinc finger

IPR007087 116 136 PS00028 Zinc finger

IPR007087 144 164 PS00028 Zinc finger

IPR007087 172 192 PS00028 Zinc finger

IPR006025 185 194 PS00142 Peptidase M

IPR007087 200 220 PS00028 Zinc finger

IPR007087 228 248 PS00028 Zinc finger

IPR007087 284 304 PS00028 Zinc finger

IPR007087 331 351 PS00028 Zinc finger

IPR007087 359 379 PS00028 Zinc finger

IPR007087 387 407 PS00028 Zinc finger

IPR007087 415 435 PS00028 Zinc finger

IPR007087 443 463 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	86	109	PD000003	Zinc finger
IPR007087	114	137	PD000003	Zinc finger
IPR007087	142	165	PD000003	Zinc finger
IPR007087	198	221	PD000003	Zinc finger
IPR007087	282	305	PD000003	Zinc finger
IPR007087	329	352	PD000003	Zinc finger
IPR007087	357	380	PD000003	Zinc finger
IPR007087	385	408	PD000003	Zinc finger
IPR007087	413	436	PD000003	Zinc finger
IPR007087	441	463	PD000003	Zinc finger
HMMPfam	IPR007087	43	65	PF00096	Zinc finger
IPR007087	86	108	PF00096	Zinc finger
IPR007087	114	136	PF00096	Zinc finger
IPR007087	142	164	PF00096	Zinc finger
IPR007087	170	192	PF00096	Zinc finger
IPR007087	198	220	PF00096	Zinc finger
IPR007087	226	248	PF00096	Zinc finger
IPR007087	282	304	PF00096	Zinc finger
IPR007087	329	351	PF00096	Zinc finger
IPR007087	357	379	PF00096	Zinc finger
IPR007087	385	407	PF00096	Zinc finger
IPR007087	413	435	PF00096	Zinc finger
IPR007087	441	463	PF00096	Zinc finger
HMMSmart	IPR015880	43	65	SM00355	Zinc finger
IPR015880	86	108	SM00355	Zinc finger
IPR015880	114	136	SM00355	Zinc finger
IPR015880	142	164	SM00355	Zinc finger
IPR015880	170	192	SM00355	Zinc finger
IPR015880	198	220	SM00355	Zinc finger
IPR015880	226	248	SM00355	Zinc finger
IPR015880	282	304	SM00355	Zinc finger
IPR015880	329	351	SM00355	Zinc finger
IPR015880	357	379	SM00355	Zinc finger
IPR015880	385	407	SM00355	Zinc finger
IPR015880	413	435	SM00355	Zinc finger
IPR015880	441	463	SM00355	Zinc finger
ProfileScan	IPR007087	43	70	PS50157	Zinc finger
IPR007087	86	113	PS50157	Zinc finger
IPR007087	114	141	PS50157	Zinc finger
IPR007087	142	169	PS50157	Zinc finger
IPR007087	170	197	PS50157	Zinc finger
IPR007087	198	225	PS50157	Zinc finger
IPR007087	226	253	PS50157	Zinc finger
IPR007087	282	309	PS50157	Zinc finger
IPR007087	329	356	PS50157	Zinc finger
IPR007087	357	384	PS50157	Zinc finger
IPR007087	385	412	PS50157	Zinc finger
IPR007087	413	440	PS50157	Zinc finger
IPR007087	441	468	PS50157	Zinc finger
ScanRegExp	IPR007087	45	65	PS00028	Zinc finger
IPR007087	88	108	PS00028	Zinc finger
IPR007087	116	136	PS00028	Zinc finger
IPR007087	144	164	PS00028	Zinc finger
IPR007087	172	192	PS00028	Zinc finger
IPR006025	185	194	PS00142	Peptidase M
IPR007087	200	220	PS00028	Zinc finger
IPR007087	228	248	PS00028	Zinc finger
IPR007087	284	304	PS00028	Zinc finger
IPR007087	331	351	PS00028	Zinc finger
IPR007087	359	379	PS00028	Zinc finger
IPR007087	387	407	PS00028	Zinc finger
IPR007087	415	435	PS00028	Zinc finger
IPR007087	443	463	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGCTGGTTGGGGATGATATG

Primer_r
: AATGTAAGAGCTGCAGTTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2439 bp
Genome contig ID	gi51511732f_67054696
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CATTGTATTCTTTCAATAAATAGCCTTCTGAGTTG
Flanking genome sequence (103839 - 103888)	----+--------+--------+--------+--------+----* AATGGGAGTCAGTTTGTCGTTTTCAATTTTCAGAACTTGGCTAAGATTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	67154696	67158533	1	99.0	Perfect prediction

Primer_f	: TAGCTGGTTGGGGATGATATG
Primer_r	: AATGTAAGAGCTGCAGTTGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1954

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information