HUGE

Gene/Protein Characteristic Table for KIAA1141

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00185
Accession No. :	AB032967
Description :	Zinc finger protein 473.
HUGO Gene Name :	zinc finger protein 473 (ZNF473)
Clone Name :	hk01833 [Vector Info]
Flexi ORF Clone :	pF1KA1141
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4566 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1713 bp

Genome contig ID gi42406306f_55121024
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
ATATTTGTTGGTTCTCTGATTAAAGTTTTGAGTCT
Flanking genome sequence
(122819 - 122868)
----+----*----+----*----+----*----+----*----+----*
AAAAGCATTGGTTCCTTCTCTCAGCCTGCTGCCATGCAGCCACGCATCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 55221024 55243841 5 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 914 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10427	100.0	zinc finger pro...	synthetic construct
Q8WTR7	99.9	Zinc finger pro...	Homo sapiens
CAH56173	99.7	hypothetical pr...	Homo sapiens
BAG63633	99.8	unnamed protein...	Homo sapiens
XP_524350	98.3	zinc finger pro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075842	7.9e-54	40.7	KIAA1962
AB058755	2.9e-52	34.2	KIAA1852
D31763	3.5e-51	40.8	KIAA0065
AB037770	3.8e-50	40.6	KIAA1349
AB046831	1.2e-49	47.0	KIAA1611

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 363 386 PD000003 Zinc finger

IPR007087 446 469 PD000003 Zinc finger

IPR007087 474 497 PD000003 Zinc finger

IPR007087 502 525 PD000003 Zinc finger

IPR007087 634 657 PD000003 Zinc finger

IPR007087 689 711 PD000003 Zinc finger

IPR007087 717 739 PD000003 Zinc finger

IPR007087 747 768 PD000003 Zinc finger

IPR007087 773 796 PD000003 Zinc finger

IPR007087 801 824 PD000003 Zinc finger

IPR007087 829 852 PD000003 Zinc finger

IPR007087 857 880 PD000003 Zinc finger

IPR007087 885 907 PD000003 Zinc finger

HMMPfam IPR001909 49 89 PF01352 KRAB box

IPR007087 252 274 PF00096 Zinc finger

IPR007087 363 385 PF00096 Zinc finger

IPR007087 390 412 PF00096 Zinc finger

IPR007087 418 440 PF00096 Zinc finger

IPR007087 446 468 PF00096 Zinc finger

IPR007087 474 496 PF00096 Zinc finger

IPR007087 502 524 PF00096 Zinc finger

IPR007087 530 552 PF00096 Zinc finger

IPR007087 605 627 PF00096 Zinc finger

IPR007087 634 656 PF00096 Zinc finger

IPR007087 689 711 PF00096 Zinc finger

IPR007087 717 739 PF00096 Zinc finger

IPR007087 745 767 PF00096 Zinc finger

IPR007087 773 795 PF00096 Zinc finger

IPR007087 801 823 PF00096 Zinc finger

IPR007087 829 851 PF00096 Zinc finger

IPR007087 857 879 PF00096 Zinc finger

IPR007087 885 907 PF00096 Zinc finger

HMMSmart IPR001909 49 107 SM00349 KRAB box

IPR015880 252 274 SM00355 Zinc finger

IPR015880 308 329 SM00355 Zinc finger

IPR015880 363 385 SM00355 Zinc finger

IPR015880 390 412 SM00355 Zinc finger

IPR015880 418 440 SM00355 Zinc finger

IPR015880 446 468 SM00355 Zinc finger

IPR015880 474 496 SM00355 Zinc finger

IPR015880 502 524 SM00355 Zinc finger

IPR015880 530 552 SM00355 Zinc finger

IPR015880 558 580 SM00355 Zinc finger

IPR015880 605 627 SM00355 Zinc finger

IPR015880 634 656 SM00355 Zinc finger

IPR015880 689 711 SM00355 Zinc finger

IPR015880 717 739 SM00355 Zinc finger

IPR015880 745 767 SM00355 Zinc finger

IPR015880 773 795 SM00355 Zinc finger

IPR015880 801 823 SM00355 Zinc finger

IPR015880 829 851 SM00355 Zinc finger

IPR015880 857 879 SM00355 Zinc finger

IPR015880 885 907 SM00355 Zinc finger

ProfileScan IPR001909 49 118 PS50805 KRAB box

IPR007087 252 279 PS50157 Zinc finger

IPR007087 308 334 PS50157 Zinc finger

IPR007087 363 390 PS50157 Zinc finger

IPR007087 390 417 PS50157 Zinc finger

IPR007087 418 445 PS50157 Zinc finger

IPR007087 446 473 PS50157 Zinc finger

IPR007087 474 501 PS50157 Zinc finger

IPR007087 502 529 PS50157 Zinc finger

IPR007087 530 557 PS50157 Zinc finger

IPR007087 558 585 PS50157 Zinc finger

IPR007087 605 632 PS50157 Zinc finger

IPR007087 634 661 PS50157 Zinc finger

IPR007087 689 716 PS50157 Zinc finger

IPR007087 717 744 PS50157 Zinc finger

IPR007087 745 772 PS50157 Zinc finger

IPR007087 773 800 PS50157 Zinc finger

IPR007087 801 828 PS50157 Zinc finger

IPR007087 829 856 PS50157 Zinc finger

IPR007087 857 884 PS50157 Zinc finger

IPR007087 885 912 PS50157 Zinc finger

ScanRegExp IPR007087 254 274 PS00028 Zinc finger

IPR007087 365 385 PS00028 Zinc finger

IPR007087 392 412 PS00028 Zinc finger

IPR007087 420 440 PS00028 Zinc finger

IPR007087 476 496 PS00028 Zinc finger

IPR007087 504 524 PS00028 Zinc finger

IPR007087 532 552 PS00028 Zinc finger

IPR007087 560 580 PS00028 Zinc finger

IPR007087 607 627 PS00028 Zinc finger

IPR007087 636 656 PS00028 Zinc finger

IPR007087 691 711 PS00028 Zinc finger

IPR007087 719 739 PS00028 Zinc finger

IPR007087 747 767 PS00028 Zinc finger

IPR007087 775 795 PS00028 Zinc finger

IPR007087 803 823 PS00028 Zinc finger

IPR007087 831 851 PS00028 Zinc finger

IPR007087 859 879 PS00028 Zinc finger

IPR007087 887 907 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	363	386	PD000003	Zinc finger
IPR007087	446	469	PD000003	Zinc finger
IPR007087	474	497	PD000003	Zinc finger
IPR007087	502	525	PD000003	Zinc finger
IPR007087	634	657	PD000003	Zinc finger
IPR007087	689	711	PD000003	Zinc finger
IPR007087	717	739	PD000003	Zinc finger
IPR007087	747	768	PD000003	Zinc finger
IPR007087	773	796	PD000003	Zinc finger
IPR007087	801	824	PD000003	Zinc finger
IPR007087	829	852	PD000003	Zinc finger
IPR007087	857	880	PD000003	Zinc finger
IPR007087	885	907	PD000003	Zinc finger
HMMPfam	IPR001909	49	89	PF01352	KRAB box
IPR007087	252	274	PF00096	Zinc finger
IPR007087	363	385	PF00096	Zinc finger
IPR007087	390	412	PF00096	Zinc finger
IPR007087	418	440	PF00096	Zinc finger
IPR007087	446	468	PF00096	Zinc finger
IPR007087	474	496	PF00096	Zinc finger
IPR007087	502	524	PF00096	Zinc finger
IPR007087	530	552	PF00096	Zinc finger
IPR007087	605	627	PF00096	Zinc finger
IPR007087	634	656	PF00096	Zinc finger
IPR007087	689	711	PF00096	Zinc finger
IPR007087	717	739	PF00096	Zinc finger
IPR007087	745	767	PF00096	Zinc finger
IPR007087	773	795	PF00096	Zinc finger
IPR007087	801	823	PF00096	Zinc finger
IPR007087	829	851	PF00096	Zinc finger
IPR007087	857	879	PF00096	Zinc finger
IPR007087	885	907	PF00096	Zinc finger
HMMSmart	IPR001909	49	107	SM00349	KRAB box
IPR015880	252	274	SM00355	Zinc finger
IPR015880	308	329	SM00355	Zinc finger
IPR015880	363	385	SM00355	Zinc finger
IPR015880	390	412	SM00355	Zinc finger
IPR015880	418	440	SM00355	Zinc finger
IPR015880	446	468	SM00355	Zinc finger
IPR015880	474	496	SM00355	Zinc finger
IPR015880	502	524	SM00355	Zinc finger
IPR015880	530	552	SM00355	Zinc finger
IPR015880	558	580	SM00355	Zinc finger
IPR015880	605	627	SM00355	Zinc finger
IPR015880	634	656	SM00355	Zinc finger
IPR015880	689	711	SM00355	Zinc finger
IPR015880	717	739	SM00355	Zinc finger
IPR015880	745	767	SM00355	Zinc finger
IPR015880	773	795	SM00355	Zinc finger
IPR015880	801	823	SM00355	Zinc finger
IPR015880	829	851	SM00355	Zinc finger
IPR015880	857	879	SM00355	Zinc finger
IPR015880	885	907	SM00355	Zinc finger
ProfileScan	IPR001909	49	118	PS50805	KRAB box
IPR007087	252	279	PS50157	Zinc finger
IPR007087	308	334	PS50157	Zinc finger
IPR007087	363	390	PS50157	Zinc finger
IPR007087	390	417	PS50157	Zinc finger
IPR007087	418	445	PS50157	Zinc finger
IPR007087	446	473	PS50157	Zinc finger
IPR007087	474	501	PS50157	Zinc finger
IPR007087	502	529	PS50157	Zinc finger
IPR007087	530	557	PS50157	Zinc finger
IPR007087	558	585	PS50157	Zinc finger
IPR007087	605	632	PS50157	Zinc finger
IPR007087	634	661	PS50157	Zinc finger
IPR007087	689	716	PS50157	Zinc finger
IPR007087	717	744	PS50157	Zinc finger
IPR007087	745	772	PS50157	Zinc finger
IPR007087	773	800	PS50157	Zinc finger
IPR007087	801	828	PS50157	Zinc finger
IPR007087	829	856	PS50157	Zinc finger
IPR007087	857	884	PS50157	Zinc finger
IPR007087	885	912	PS50157	Zinc finger
ScanRegExp	IPR007087	254	274	PS00028	Zinc finger
IPR007087	365	385	PS00028	Zinc finger
IPR007087	392	412	PS00028	Zinc finger
IPR007087	420	440	PS00028	Zinc finger
IPR007087	476	496	PS00028	Zinc finger
IPR007087	504	524	PS00028	Zinc finger
IPR007087	532	552	PS00028	Zinc finger
IPR007087	560	580	PS00028	Zinc finger
IPR007087	607	627	PS00028	Zinc finger
IPR007087	636	656	PS00028	Zinc finger
IPR007087	691	711	PS00028	Zinc finger
IPR007087	719	739	PS00028	Zinc finger
IPR007087	747	767	PS00028	Zinc finger
IPR007087	775	795	PS00028	Zinc finger
IPR007087	803	823	PS00028	Zinc finger
IPR007087	831	851	PS00028	Zinc finger
IPR007087	859	879	PS00028	Zinc finger
IPR007087	887	907	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATCATTCACCATTTATCCAGG

Primer_r
: GTCAACTAACAGCAATCGTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1713 bp
Genome contig ID	gi42406306f_55121024
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- ATATTTGTTGGTTCTCTGATTAAAGTTTTGAGTCT
Flanking genome sequence (122819 - 122868)	----+--------+--------+--------+--------+----* AAAAGCATTGGTTCCTTCTCTCAGCCTGCTGCCATGCAGCCACGCATCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	55221024	55243841	5	99.1	Perfect prediction

Primer_f	: ATCATTCACCATTTATCCAGG
Primer_r	: GTCAACTAACAGCAATCGTCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1141

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information