HUGE

Gene/Protein Characteristic Table for KIAA0784

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04057
Accession No. :	AB018327
Description :	Activity-dependent neuroprotector.
HUGO Gene Name :	activity-dependent neuroprotector homeobox (ADNP)
Clone Name :	hk05410 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4282 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1059 bp

Genome contig ID gi51511747r_48840290
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
AGCATCTAAATAAATTGCTGTATTGTGCTTAATGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATATTTGCTTTATTACACATGACAGTCCTGTGTGTCCATTATATCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 48940290 48953854 3 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1073 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H2P0	100.0	Activity-depend...	Homo sapiens
BAG37275	99.9	unnamed protein...	Homo sapiens
AAH75794	99.8	Activity-depend...	Homo sapiens
XP_001168472	99.7	activity-depend...	Pan troglodytes
XP_001095183	99.5	similar to acti...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020670	3.2e-10	26.3	KIAA0863

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 483 506 PF00096 Zinc finger

IPR001356 735 784 PF00046 Homeobox

HMMSmart IPR015880 45 68 SM00355 Zinc finger

IPR015880 78 100 SM00355 Zinc finger

IPR015880 136 159 SM00355 Zinc finger

IPR015880 192 215 SM00355 Zinc finger

IPR015880 418 440 SM00355 Zinc finger

IPR015880 460 481 SM00355 Zinc finger

IPR015880 483 506 SM00355 Zinc finger

IPR015880 593 618 SM00355 Zinc finger

IPR001356 728 789 SM00389 Homeobox

ProfileScan IPR007087 483 511 PS50157 Zinc finger

IPR001356 742 785 PS50071 Homeobox

ScanRegExp IPR003439 312 326 PS00211 ABC transporter related

IPR007087 485 506 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	483	506	PF00096	Zinc finger
IPR001356	735	784	PF00046	Homeobox
HMMSmart	IPR015880	45	68	SM00355	Zinc finger
IPR015880	78	100	SM00355	Zinc finger
IPR015880	136	159	SM00355	Zinc finger
IPR015880	192	215	SM00355	Zinc finger
IPR015880	418	440	SM00355	Zinc finger
IPR015880	460	481	SM00355	Zinc finger
IPR015880	483	506	SM00355	Zinc finger
IPR015880	593	618	SM00355	Zinc finger
IPR001356	728	789	SM00389	Homeobox
ProfileScan	IPR007087	483	511	PS50157	Zinc finger
IPR001356	742	785	PS50071	Homeobox
ScanRegExp	IPR003439	312	326	PS00211	ABC transporter related
IPR007087	485	506	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTAGACCTATTCAAGTGATGC

Primer_r
: AGCGTTTATTACACAGCAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1059 bp
Genome contig ID	gi51511747r_48840290
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AGCATCTAAATAAATTGCTGTATTGTGCTTAATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATTTGCTTTATTACACATGACAGTCCTGTGTGTCCATTATATCTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	48940290	48953854	3	99.0	Perfect prediction

Primer_f	: TTAGACCTATTCAAGTGATGC
Primer_r	: AGCGTTTATTACACAGCAAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0784

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information