HUGE

Gene/Protein Characteristic Table for KIAA0863

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00665
Accession No. :	AB020670
Description :	Zinc finger protein 508.
HUGO Gene Name :	ADNP homeobox 2 (ADNP2)
Clone Name :	hk06535 [Vector Info]
Flexi ORF Clone :	pF1KSDA0863
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4313 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 732 bp

Genome contig ID gi51511735f_75868257
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GAGTTATTTTACAAATAAATTTATTCTGTAGATGC
Flanking genome sequence
(130157 - 130206)
----+----*----+----*----+----*----+----*----+----*
AGAAATATTTTTCAGTGTAGATTTTCCCTTTTGATATGCTAAGTCATTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 75968173 75998412 4 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1181 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_512186	99.2	zinc finger pro...	Pan troglodytes
XP_001110872	97.8	similar to Acti...	Macaca mulatta
AAI66606	79.6	Adnp2 protein [...	Rattus norvegicus
XP_001496130	86.2	similar to ADNP...	Equus caballus
AAI47928	84.7	ADNP2 protein [...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018327	2.6e-05	26.3	KIAA0784

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR015880 123 146 SM00355 Zinc finger

IPR015880 156 178 SM00355 Zinc finger

IPR015880 205 228 SM00355 Zinc finger

IPR015880 265 290 SM00355 Zinc finger

IPR015880 744 766 SM00355 Zinc finger

IPR015880 797 818 SM00355 Zinc finger

IPR015880 820 843 SM00355 Zinc finger

IPR015880 925 948 SM00355 Zinc finger

IPR001356 1093 1155 SM00389 Homeobox

ProfileScan IPR007087 820 848 PS50157 Zinc finger

ScanRegExp IPR007087 822 843 PS00028 Zinc finger

IPR007087 927 949 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR015880	123	146	SM00355	Zinc finger
IPR015880	156	178	SM00355	Zinc finger
IPR015880	205	228	SM00355	Zinc finger
IPR015880	265	290	SM00355	Zinc finger
IPR015880	744	766	SM00355	Zinc finger
IPR015880	797	818	SM00355	Zinc finger
IPR015880	820	843	SM00355	Zinc finger
IPR015880	925	948	SM00355	Zinc finger
IPR001356	1093	1155	SM00389	Homeobox
ProfileScan	IPR007087	820	848	PS50157	Zinc finger
ScanRegExp	IPR007087	822	843	PS00028	Zinc finger
IPR007087	927	949	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCGATCTCCTTCAGCTTTCCC

Primer_r
: GAAGTCAGCGTAAGTTAATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCGATCTCCTTCAGCTTTCCC
Primer_r	: GAAGTCAGCGTAAGTTAATGC
PCR product length	: 126 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	732 bp
Genome contig ID	gi51511735f_75868257
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GAGTTATTTTACAAATAAATTTATTCTGTAGATGC
Flanking genome sequence (130157 - 130206)	----+--------+--------+--------+--------+----* AGAAATATTTTTCAGTGTAGATTTTCCCTTTTGATATGCTAAGTCATTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	75968173	75998412	4	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0863

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information