| HUGE |
Gene/Protein Characteristic Table for KIAA0810 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07289 |
|---|---|
| Accession No. : | AB018353 |
| Description : | Sad1/unc-84 protein-like 1. |
| HUGO Gene Name : | unc-84 homolog A (C. elegans) (UNC84A) |
| Clone Name : | hk05647s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA0810
![]() |
| Source : | Human adult brain |
| Note : | We replaced hk05647, former representative clones for KIAA0810 with hk05647s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4047 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1571 bp Genome contig ID gi89161213f_738664 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
GAGGTTTAAATAAAGAGTTTTAATTTTTAAAAGGGFlanking genome sequence
(142403 - 142452) ----+----*----+----*----+----*----+----*----+----*
CATGGGATATAAACAGTCTATTTCTTTTCTCAGTTTGTCTGTTTCTGCCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 838657 881065 21 99.7 Terminal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 824 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GCAGCAGAAGCACTACCAAAG | |
| : ACTGATTTGGGATTTGGGGTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 7 |
| : GeneBridge 4 | |
| : GCAGCAGAAGCACTACCAAAG | |
| : ACTGATTTGGGATTTGGGGTG | |
| : 130 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |