HUGE |
Gene/Protein Characteristic Table for KIAA0810 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07289 |
---|---|
Accession No. : | AB018353 |
Description : | Sad1/unc-84 protein-like 1. |
HUGO Gene Name : | unc-84 homolog A (C. elegans) (UNC84A) |
Clone Name : | hk05647s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0810 |
Source : | Human adult brain |
Note : | We replaced hk05647, former representative clones for KIAA0810 with hk05647s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4047 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1571 bp Genome contig ID gi89161213f_738664 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
GAGGTTTAAATAAAGAGTTTTAATTTTTAAAAGGGFlanking genome sequence
(142403 - 142452) ----+----*----+----*----+----*----+----*----+----*
CATGGGATATAAACAGTCTATTTCTTTTCTCAGTTTGTCTGTTTCTGCCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 838657 881065 21 99.7 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 824 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GCAGCAGAAGCACTACCAAAG | |
: ACTGATTTGGGATTTGGGGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: GCAGCAGAAGCACTACCAAAG | |
: ACTGATTTGGGATTTGGGGTG | |
: 130 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |