HUGE |
Gene/Protein Characteristic Table for KIAA0822 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04008 |
---|---|
Accession No. : | AB020629 |
Description : | ATP-binding cassette sub-family A member 8. |
HUGO Gene Name : | ATP-binding cassette, sub-family A (ABC1), member 8 (ABCA8) |
Clone Name : | hh02681 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5677 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 793 bp Genome contig ID gi51511734r_64275028 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
GAAAATGTGAAATAAATCTCATATATATAGTTTTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAATACGTTTTCTATTTCATGTGTCTTTTTCTTAACTCGGTGGCTTCCTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 64375028 64463087 38 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1591 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTTCTGTAAGCCAACTGTGTG | |
: TTCTACCTACTCAGTCATGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: GeneBridge 4 | |
: TTTCTGTAAGCCAACTGTGTG | |
: TTCTACCTACTCAGTCATGTG | |
: 153 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |