HUGE

Gene/Protein Characteristic Table for KIAA0827

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01608
Accession No. :	AB020634
Description :	Nuclear factor of activated T-cells 5.
HUGO Gene Name :	nuclear factor of activated T-cells 5, tonicity-responsive (NFAT5)
Clone Name :	hh03726 [Vector Info]
Flexi ORF Clone :	pF1KSDA0827
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6019 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1105 bp

Genome contig ID gi51511732f_68057388
PolyA signal sequence
(TATAAA,-10)
+----*----+----*----+----*----+----
AATTTTTCCCTCTAATAGGAAACAGTATAAATTTT
Flanking genome sequence
(231474 - 231523)
----+----*----+----*----+----*----+----*----+----*
AATTAAAAAAAAAAGGCAAACTAAAATTTCTTGAAATATCACTTCTCCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 68157388 68288860 14 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1608 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001093880	99.1	similar to nucl...	Macaca mulatta
O94916	100.0	Nuclear factor ...	Homo sapiens
XP_001168930	97.1	nuclear factor ...	Pan troglodytes
NP_619727	98.8	nuclear factor ...	Homo sapiens
AAI31510	98.8	NFAT5 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028971	0.00056	26.9	KIAA1048

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR008366 384 400 PR01789 Nuclear factor of activated T cells (NFAT)

IPR008366 502 524 PR01789 Nuclear factor of activated T cells (NFAT)

IPR008366 543 562 PR01789 Nuclear factor of activated T cells (NFAT)

IPR008366 601 620 PR01789 Nuclear factor of activated T cells (NFAT)

HMMPfam IPR011539 359 516 PF00554 Rel homology

IPR002909 522 618 PF01833 Cell surface receptor IPT/TIG

HMMSmart IPR002909 521 619 SM00429 Cell surface receptor IPT/TIG

ProfileScan IPR011539 341 520 PS50254 Rel homology

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008366	384	400	PR01789	Nuclear factor of activated T cells (NFAT)
IPR008366	502	524	PR01789	Nuclear factor of activated T cells (NFAT)
IPR008366	543	562	PR01789	Nuclear factor of activated T cells (NFAT)
IPR008366	601	620	PR01789	Nuclear factor of activated T cells (NFAT)
HMMPfam	IPR011539	359	516	PF00554	Rel homology
IPR002909	522	618	PF01833	Cell surface receptor IPT/TIG
HMMSmart	IPR002909	521	619	SM00429	Cell surface receptor IPT/TIG
ProfileScan	IPR011539	341	520	PS50254	Rel homology

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGGAGAAACTGAAGGGTAAC

Primer_r
: GAAACCCAGAGAACTAACAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTGGAGAAACTGAAGGGTAAC
Primer_r	: GAAACCCAGAGAACTAACAAC
PCR product length	: 161 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1105 bp
Genome contig ID	gi51511732f_68057388
PolyA signal sequence (TATAAA,-10)	+--------+--------+----*----+---- AATTTTTCCCTCTAATAGGAAACAGTATAAATTTT
Flanking genome sequence (231474 - 231523)	----+--------+--------+--------+--------+----* AATTAAAAAAAAAAGGCAAACTAAAATTTCTTGAAATATCACTTCTCCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	68157388	68288860	14	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0827

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information