HUGE |
Gene/Protein Characteristic Table for KIAA0827 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01608 |
---|---|
Accession No. : | AB020634 |
Description : | Nuclear factor of activated T-cells 5. |
HUGO Gene Name : | nuclear factor of activated T-cells 5, tonicity-responsive (NFAT5) |
Clone Name : | hh03726 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0827
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6019 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1105 bp Genome contig ID gi51511732f_68057388 PolyA signal sequence
(TATAAA,-10) +----*----+----*----+----*----+----
AATTTTTCCCTCTAATAGGAAACAGTATAAATTTTFlanking genome sequence
(231474 - 231523) ----+----*----+----*----+----*----+----*----+----*
AATTAAAAAAAAAAGGCAAACTAAAATTTCTTGAAATATCACTTCTCCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 68157388 68288860 14 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1608 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTGGAGAAACTGAAGGGTAAC | |
: GAAACCCAGAGAACTAACAAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: GeneBridge 4 | |
: TTGGAGAAACTGAAGGGTAAC | |
: GAAACCCAGAGAACTAACAAC | |
: 161 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |