HUGE

Gene/Protein Characteristic Table for KIAA0835

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01126
Accession No. :	AB020642
Description :	Myelin transcription factor 1.
HUGO Gene Name :
Clone Name :	hj05861 [Vector Info]
Flexi ORF Clone :	pF1KA0835
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5533 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1803 bp

Genome contig ID gi51511747f_62166271
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GGGTGATTTCCTAATAAAAGTCCACTCTGACTGTG
Flanking genome sequence
(177779 - 177828)
----+----*----+----*----+----*----+----*----+----*
AATCGGTGCTGTGGTCTGTGGGGAGGACATTGTCTCCATTCTTGGTGAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 62266271 62344048 23 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1167 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q01538	100.0	Myelin transcri...	Homo sapiens
CAM20796	90.1	myelin transcri...	Mus musculus
Q8CFC2	90.8	Myelin transcri...	Mus musculus
XP_543112	89.2	similar to Myel...	Canis lupus fam...
EDL07462	90.8	myelin transcri...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028973	6.2e-142	100.0	KIAA1050
AB029029	2.5e-72	48.4	KIAA1106
AB011107	9.4e-61	45.4	KIAA0535

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002515 73 103 PF01530 Zinc finger

IPR002515 485 515 PF01530 Zinc finger

IPR002515 529 559 PF01530 Zinc finger

IPR013681 606 820 PF08474 Myelin transcription factor 1

IPR002515 843 873 PF01530 Zinc finger

IPR002515 887 917 PF01530 Zinc finger

IPR002515 936 966 PF01530 Zinc finger

IPR002515 989 1019 PF01530 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002515	73	103	PF01530	Zinc finger
IPR002515	485	515	PF01530	Zinc finger
IPR002515	529	559	PF01530	Zinc finger
IPR013681	606	820	PF08474	Myelin transcription factor 1
IPR002515	843	873	PF01530	Zinc finger
IPR002515	887	917	PF01530	Zinc finger
IPR002515	936	966	PF01530	Zinc finger
IPR002515	989	1019	PF01530	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGCTGTGCAGATGTGTATGG

Primer_r
: TACCCTCTGACCTTGATGATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGCACTCCCTCACAGCAACAG
Primer_r	: GGCACGGATAACAGCAAATGG
PCR product length	: 138 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1803 bp
Genome contig ID	gi51511747f_62166271
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GGGTGATTTCCTAATAAAAGTCCACTCTGACTGTG
Flanking genome sequence (177779 - 177828)	----+--------+--------+--------+--------+----* AATCGGTGCTGTGGTCTGTGGGGAGGACATTGTCTCCATTCTTGGTGAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	62266271	62344048	23	99.7	Perfect prediction

Primer_f	: AGGCTGTGCAGATGTGTATGG
Primer_r	: TACCCTCTGACCTTGATGATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0835

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information